Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... M. Amblar and C. M. Arraiano 374 FEBS Journal 272 (2005) 363–374 ª 2004 FEBS A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding Mo ´ nica ... (rnb296) encodes an inactive RNase II enzyme [25]. In this report we demonstrate that the single amino acid sub- stitution Asp209fiAsn in RNase II is able...
Ngày tải lên: 30/03/2014, 15:20
... of the psbA mRNA is not affected in the mf2 strain The dramatic decrease in D1 synthesis in mf1 and mf2 strains did not correlate with any significant changes in the accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a template. T...
Ngày tải lên: 07/03/2014, 15:20
... A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Paola Turina and B. Andrea Melandri Department ... for assessing theroleofGlu210intheprotonpathwaywithinF 0 . Alternatively, it can be t hat the mutation has an even longer-range effect, affecting t he conformation at the...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...
Ngày tải lên: 07/03/2014, 12:20
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca 2+ - binding site in the mammalian enzymes and are thermally Fig. ... Amphibian DNasesIhaveaSer205insertioninaCa 2+ -binding site of mammalian and avian enzymes that reduces their thermal stabilities [Takeshita, H., Yasuda, T., Iida, R., Nakajima, T...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... from the host protein remained unchanged. The impaired metal -binding ability caused by Asp to Ala mutations at positions 1 and 3 echoed a previous observation that these mutations in the intact STIM1 ... Ca 2+ signal change and the accompa- nying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulti...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... mole- cular sieve chromatography. Each protein variant eluted as a single species; however, all protein variants exhibited larger elution volumes indicating a lower apparent mass (Table 2). These data ... Interestingly, all protein variants show a drastically reduced quinone reductase activity in steady-state kinetics. Detailed analysis of the two half reactions revealed that the...
Ngày tải lên: 30/03/2014, 01:20
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx
... feature specifica- tions; the latter are themselves items consisting of a feature name and a feature value in an ar- rangement. The formal devices already introduced allow us to state cooccurrence ... restrictions gov- erning the combination of features and values in feature specifications; the definition of the value range of a feature can thus be regarded as anot...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... demon- strate a strong conservation in the binding of C-terminal binding protein- interacting domains despite great variability in their amino acid sequences. Finally, this L22 5A point mutation could also ... with the structural data and the universal conservation of this residue in all C-terminal binding pro- tein-interacting motifs, mutation of the central leucin...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... years, to anoxia and diapause, conditions that are invaria- bly accompanied by large increases in intracellular Ca 2+ [3]. Despite intense research on the mammalian PTP since its characterization by ... for 10 passages. The homog- enate was centrifuged for 10 min at 300 g and 4 °C, the upper fatty layer of the supernatant was aspirated, and the remaining supernatant was centrifuge...
Ngày tải lên: 29/03/2014, 00:20