Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... M. Amblar and C. M. Arraiano374 FEBS Journal 272 (2005) 363–374 ª 2004 FEBS A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding Mo´nica ... (rnb296)encodes an inactive RNase II enzyme [25]. In thisreport we demonstrate that the single amino acid sub-stitution Asp209fiAsn in RNase II is able to cause the total inactivation of the enzyme without ... His(6)-RNase IID209N(RNase IID209N) protein is indicated with an arrow. St, molecular mass maker.M. Amblar and C. M. Arraiano RNase II mutant with RNA binding but no activityFEBS Journal 272...
- 12
- 320
- 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... of the psbAmRNA is not affected in the mf2strain The dramatic decrease in D1 synthesis in mf1 and mf2 strainsdid not correlate with any significant changes in the accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCCATG GAA TCG ATG TAT AAA CGG TTT TCA GTTGAA GT-3¢,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a template. The resultingDNA fragment ... 52 column. Heptanoic acid was used asan internal standard.Results The absence of functional PSII and lack of PG-C16:1(3t)result from a single nuclear mutation To assess the relation between...
- 10
- 411
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... A point mutation in the ATP synthase ofRhodobacter capsulatusresults in differential contributions of DpH and Du in driving the ATP synthesis reactionPaola Turina and B. Andrea MelandriDepartment ... for assessingtheroleofGlu210intheprotonpathwaywithinF0.Alternatively, it can be t hat the mutation has an evenlonger-range effect, affecting t he conformation at the interface between the ... shieldedagainst actinic light by a copper sulfate solution. The amount of sy nthetized ATP w as evaluated by a dding10–25 nMstandard ATP.ATP synthesis induced by acid-base transitionsAcid-base...
- 9
- 580
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline).Name Size (nt) SequenceCLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE...
- 16
- 397
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... from a thermally unstableone: frog, toad and newt DNases I all have a Ser205insertion in a domain that contains an essential Ca2+- binding site in the mammalian enzymes and are thermallyFig. ... AmphibianDNasesIhaveaSer205insertioninaCa2+ -binding site ofmammalian and avian enzymes that reduces their thermalstabilities [Takeshita, H., Yasuda, T., Iida, R., Nakajima, T.,Mori, S., Mogi, K., Kaneko, Y. & Kishi, ... acquired, main-tained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised1985).Analytical methodsDNase I activity was assayed by the previously...
- 8
- 500
- 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... from the host protein remainedunchanged. The impaired metal -binding ability causedby Asp to Ala mutations at positions 1 and 3 echoed a previous observation that these mutations in the intactSTIM1 ... Ca2+signal change and the accompa-nying conformational change in the canonical EF-handare probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting in the oligomeriza-tion ... of the engineered protein with the grafted EF-hand Ca2+ -binding motif (magenta) from STIM1. W32 and Y76 in the host protein are about 15 A ˚away from the grafted Ca2+ -binding sites. Ca2+is...
- 9
- 465
- 0
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... mole-cular sieve chromatography. Each protein varianteluted as a single species; however, all protein variantsexhibited larger elution volumes indicating a lowerapparent mass (Table 2). These data ... Interestingly, all protein variants show a drastically reduced quinonereductase activity in steady-state kinetics. Detailed analysis of the two halfreactions revealed that the oxidative half reaction ... lL samples containing 1–3 mgÆmL)1protein were scanned at a heating rate of 1 °CÆmin)1at a temperature in the range 5–110 °C.X-ray crystal structures The YhdA variants were crystallized at...
- 12
- 407
- 0
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx
... feature specifica- tions; the latter are themselves items consisting of a feature name and a feature value in an ar- rangement. The formal devices already introduced allow us to state cooccurrence ... restrictions gov- erning the combination of features and values in feature specifications; the definition of the value range of a feature can thus be regarded as another special case of cooccurrence ... a genuine gain in expressiveness for the formalism. Other devices, such as Feature Instantiation Principles and Linear Precedence Statements can be regarded as special cases of CCRs. The proposals...
- 4
- 294
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... demon-strate a strong conservation in the binding of C-terminal binding protein-interacting domains despite great variability in their amino acid sequences.Finally, this L22 5A point mutation could also ... with the structural dataand the universal conservation of this residue in all C-terminal binding pro-tein-interacting motifs, mutation of the central leucine residue (leucine 225 in HIC1) abolishes ... phosphorylation) and binding toneural nitric oxide synthase, a PDZ domain-containingprotein [22,23]. In contrast, CtBP2 is mainly nuclear,due to a specific N-terminal 20 amino acid regioncontaining Lys...
- 12
- 326
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... years,to anoxia and diapause, conditions that are invaria-bly accompanied by large increases in intracellularCa2+[3].Despite intense research on the mammalian PTPsince its characterization by ... for 10 passages. The homog-enate was centrifuged for 10 min at 300 g and 4 °C, the upper fatty layer of the supernatant was aspirated, and the remaining supernatant was centrifuged at 11 300 ... Yoshimura Y, Gouda S,Kawashima S, Yamazaki N, Yamashita K, Kataoka M,Nagata T, Terada H et al. (2009) Ca(2+)-inducedpermeability transition can be observed even in yeastmitochondria under optimized...
- 15
- 505
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ