Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... 432 2– 433 7 ª 2010 The Authors Journal compilation ª 2010 FEBS 433 7 A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation ... primer pGAD-CARP Full-length CARP CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG pGAD-DNter2 CARP from 71 to 31 9 GAGCCATGGAACAACG...
Ngày tải lên: 29/03/2014, 21:20
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 941–948, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Comparative Study of Hypothesis Alignment ... words of the new link are un- aligned and this link exists in the union of two word alignments. If there are more than two links share a same hypothesi...
Ngày tải lên: 17/03/2014, 01:20
... The parameters of the model are estimated from the frequency of n character sequences of the alphabet (n-gram) on a corpus containing a large number of sentences of a language. This is the ... tropy of a POS-based 2-graxa model, a word-based 2-gram model and a class-based 2-graxa model, es- timated from information theoretical point of view. As f...
Ngày tải lên: 31/03/2014, 04:20
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... b-catenin, suggesting that a- defensins activate the b-catenin signaling pathway. We then studied the role of the b-catenin signaling pathway in a- defensin- induced increases in the proliferation and ... indicate that a- defensin-induced increases in lung fibroblast proliferation and collagen synthesis involve the b-catenin signaling pathway. Inhibition of b-ca...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf
... learn an optimal ranking model of text quality. Learning a ranking directly, rather than fitting a classifier score to a grade point scale after training, is both a more generic approach to the ... which are anonymised, are annotated using XML and linked to meta-data about the question prompts, the candi- date’s grades, native language and age. The FCE writing component...
Ngày tải lên: 20/02/2014, 04:20
Báo cáo khoa học: A new bright green-emitting fluorescent protein – engineered monomeric and dimeric forms pptx
... the AC dimerization interface. In DsRed, His162 of the A monomer is involved in a stacking interaction with His162 of the adjacent C monomer, whilst simultaneously making an electro- static interaction ... the new FP and relation to other known FPs A new FP, VFP, was isolated and cloned from the C. microphthalma coral, collected in 1.2 m of water off Li...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... underlined; the signal peptide part is in italics. The Ca 2+ -binding loop is in bold, and the catalytic dyad (H ⁄ D) is in bold italics. The unique asparagine is indi- cated by an arrow. The asterisk ... PLA 2 (PDB 1vip). Amino acids involved in catalysis are in blue, and disulfide bridges are in yel- low. The unique asparagine of UcPLA 2 is in mage...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (19 93) Isolation and characterization of recombinant human cathepsin E expressed in ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal a...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... bases (enamino ketones), which possess a common cyclohexenone ring system linked by an aminoacidoranamino-alcohol[11].Incontrast,MAAsare UV absorbing metabolites of algae that contain an amino- cyclohexenimine ... provided protection against UV-B damage in a dose-related manner. DNA is the primary cutaneous target of UV radiation. Upon exposure of DNA to wavelengths approachin...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... Columbia, MD, USA) with sense primer SOE -3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG -3 ) and antisense primer SOE-4 (5¢-GAAT GCGGCCGCTTACT TGTAACAGCTCGTCCATG -3 ), which introduced a NotI site (underlined). ... 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC -3 and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGCCAACTT -3 ,which introduced a NotI site (underlined) and a SacI site (bold)....
Ngày tải lên: 07/03/2014, 21:20