Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... FEBS Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles Asaka Yamane 1, *, Mina Fukui 1, *, Yoshiaki Sugimura 1 , Miho Itoh 1 , ... T, Fleckman P, Dale BA & Maki M (20 03) Analysis of epidermal- type transglutaminase (transglutaminase 3) in human stratified epithe...
Ngày tải lên: 29/03/2014, 21:20
... methyltransferase 1 and 3 toward the Ewing sarcoma protein and a peptide. Proteins 61, 164–175. 48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S, Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, ... oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation doma...
Ngày tải lên: 15/02/2014, 01:20
... Synthesis and characteriza- tion of lipooligosaccharide-based conjugates as vaccine candidates for Moraxella (Branhamella) catarrhalis. Infect Immun 66, 1891–1897. 51 Caroff M, Tacken A & Szabo ... TGA TGA TGG CAA CTC (atr antisense) This study asd1 AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 706–7 23 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–4 83 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG ... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAbrR...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involved in ... 5A) . Although the same band was obtained after digestion Fig. 3. 45 Ca overlay analysis of fusions of GST and recombinant OMM-64 variants (rOMM-64-I-V and -C),...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259 CD 237 904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA ... 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095 731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109 DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114 BC...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG -3 ,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG -3 , DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG -3 , DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG -3 . PAL0: 5¢-CGCAAGGT CATGACCTCG -3 . One strand of each ... domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding domai...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... osmoregulation. The discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembrane transport [1]. Aquaporins and aquaglyceroporins [the major intrinsic protein ... Within the N-terminal regulatory domain S246P + Q592 stop TCTfiCCT + CAAfiTAA Between the N-terminal regulatory domain and TMD1 K250E AAAfiGAA Between the N-terminal regulatory d...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... )525 (5¢-TGACCTTGTCTCGTTGCCTCACCC -3 )and )37 8 (5¢-GCTACAGGGATGCCAAAAGAACCC -3 )forthe Site -3, and primer set )34 6 (5¢-GCGTCTCACCCTAGT CCTGGTCCTGC -3 )and) 214 (5¢-GGAAGGGGCGGG TCCAGAGAACA -3 ) for the ... and autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA -3 ;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA -3 ;Site-2wt,5¢-GCGT CTCACCCTAGTCC...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... glycoforms observed for strain NM115, whereas 3 Hex glycoforms were also observed for strains 425/ 93 and 1000 (Table 1). Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined ... H-4 b-GlcNAc i 4.72 3. 81 3. 75 3. 75 3. 59 Gal-I H -3, Gal-I H-4 ii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H -3, Gal-I H-4 iii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H...
Ngày tải lên: 08/03/2014, 02:20