Ca-125: A Useful Marker to Distinguish Pulmonary Tuberculosis from Other Pulmonary Infections pptx

... including pleural, peritoneal, pelvic, milliary, and intra- abdominal disease. The diagnostic value of Ca-125 to help differentiate pulmonary tuberculosis from other pulmonary infections has been ... initiation of TB therapy and respiratory isolation. However, in some cases of pulmonary TB acid-fast bacilli stains in sputum samples may be negative or respiratory specimens...

Ngày tải lên: 29/03/2014, 03:20

... that other Taiwanese hospitals and health care centers con- Table 2: Length of time from admission to alarm, alarm to diagnostic action, admission to diagnosis, and diagnosis to treatment via ... physician might make a diagnosis of TB based on clinical manifestations (symptoms) of the patient. Statistical analysis Categorical data is presented as numbers with percent- ages and...

Ngày tải lên: 06/03/2014, 04:20

... studies for missing data or clarifications. All data will be entered into a database manager. A draft data extraction form is included in Appendix 2 Assessment of methodological quality Two reviewers ... criteria that need to be met for each study to be rated as yes, no, or unclear for each of the QUADAS items. Statistical analysis and data synthesis The first step in data analysis wil...

Ngày tải lên: 06/03/2014, 04:20

... bacilli AIDS Acquired immunodeficiency syndrome ANU Australian National University BTA Basil tahan asam (acid-fast bacilli) CI Confidence interval Dinas Dinas Kesehatan (District Health Authority) ... Mycobacterium vaccae immunotherapy for treating tuberculosis. Cochrane Database Syst Rev 2003:CD001166. 53. Mwinga A, Nunn A, Ngwira B, et al. Mycobacterium vaccae (SRL172) immunotherapy...

Ngày tải lên: 06/03/2014, 04:20

... such as A (Ala) or D (Asp). Only AaHIT 4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position. AaHIT 4 ,the unique anti-insect toxin also has a toxic effect on mammals and ... into pSPORT I. The primers A3 were as follows: 5¢-GCC GGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and...

Ngày tải lên: 31/03/2014, 09:20

... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... medical intensive care units Khalid Abidi 1 , Ibtissam Khoudri 1 , Jihane Belayachi 1 , Naoufel Madani 1 , Aicha Zekraoui 1 , Amine Ali Zeggwagh 1,2 and Redouane Abouq...

Ngày tải lên: 25/10/2012, 10:35

... manu- script and made critical revision to the paper. THZ and XHL performed data collection and analysis and helped to draft the manuscript. YPZ participated in the data collection, analysis and ... whole day ' (Male, 22 years old, intensive phase, inpatient) 'I have nothing to do at home, one month, another month. I am bored to death! After all, I am a young man.'...

Ngày tải lên: 15/02/2014, 12:20

... Medical City, Riyadh, Saudi Arabia (Abdullah A. Alshimemeri, Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, and Othman Al Harbi) and Ministry of Health, Riyadh, Saudi Arabia (Ziad Memish) Address ... Yaseen M. Arabi, Hamdan Al-Jahdali, Ashwaq Olayan, Othman Al Harbi, Ziad Memish Crit Care & Shock (2011) 14:1-6 Abstract Objective: To examine the presentation and outcome of patient...

Ngày tải lên: 15/02/2014, 12:20

... whole. ACKNOWLEDGEMENT The authors wish to thank Dr A. N. Aggarwal (Associate Professor, Department of Pulmonary Medicine, PGIMER, Chandigarh) for his help in the biostatistical analysis of the data. Pulmonary Tuberculosis ... literature on manifestations of pulmonary tuberculosis (PTB) among elderly patients in India. The aim of the present study was to compare the clinical, r...

Ngày tải lên: 15/02/2014, 13:20

...

Ngày tải lên: 15/02/2014, 13:20