boundaries a personal response to learning in and from practice

... social and cultural differences in particular countries and settings? In what ways are practices of teaching and learning mathematics made available for study? How is practice made visible and accessible ... on the two main strands of interest— Teacher Preparation and the Early Years of Teaching and Professional Learning for and in Practice and invited proposals for participation in a study conference ... DeBlois, R Leikin Editor: Terry Wood Learning in and from Practice: Comments and Reflections 227 Aline Robert Established Boundaries? A Personal Response to Learning in and from Practice ...

Ngày tải lên: 13/02/2015, 06:00

... Programming for Engineers Aaron R Bradley Programming for Engineers A Foundational Approach to Learning C and Matlab Aaron R Bradley Dept of Electrical, Computer, and Energy Engineering University ... Both are pointing to variables according to their types: x, an int *, points to an int; and y, an int **, points to an int * Notice how the types can be read in reverse: int * is read as “pointer ... is to initialize variables at declaration: { int a = , b = 0; a = b; } In practice it is not always possible to find reasonable values to which to initialize variables, and one can still unintentionally...

Ngày tải lên: 19/03/2014, 14:05

... blocked In addition, tertiary and quaternary responses were restored following discontinuation of abatacept administration, demonstrating that tolerance to these neoantigens was not induced [8] In ... levels Anti-tetanus and anti-pneumococcal (Danish serotypes 2, 6B, 8, 9V, 14, 19F and 23F) antibody titers were measured by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept ... antibody response in healthy subjects prior to initiating studies in RA patients Tetanus toxoid vaccine and the 23-valent pneumococcal vaccine were used to assess the impact of abatacept on a...

Ngày tải lên: 09/08/2014, 10:20

... organism [6,7] In the initial phase of infection, Listeria binds to splenic macrophages and is internalized; Listeria produces products that activate nuclear factor-kappa B and upregulate innate ... be activated directly by microbial products However, RAGE ligands inducibly expressed upon macrophage activation may potentiate initial innate activation and the systemic inflammatory response ... perhaps other RAGE ligands as well) HMGB-1 may stimulate interferon-γ (IFN-γ)-producing cells and thus mediate macrophage activation Furthermore, HMGB-1 may directly activate macrophages via RAGE...

Ngày tải lên: 13/08/2014, 10:20

... between- and within-subjects factors as well as the interaction between factors and covariates and its effects are analyzed The difference between LR and GLM repeated measures analysis is that LR ... (template denaturation), 1min at 55οC (primer annealing), 1min at 72οC (primer extension) and finally, 7min at 72οC (final elongation) The PCR product was analyzed on a 2% agarose/Tris-borate EDTA gel ... such data but it is more demanding in the quantity of available data In the LR analysis, the kinetic parameters were modeled based on sex, presence of CYP 3A5 *1 allele, age at transplantation...

Ngày tải lên: 26/10/2012, 09:32

Ngày tải lên: 08/11/2012, 15:18

... Shubha and Shilesh, their spouses Chuck Harris and Nupur Parikh and his two lovely grandchildren Reya and Azad; all his teachers and mentors during his entire career; and his parents who would have ... Technology Group and has 25 years of experience in engineering, with expertise in water and wastewater treatment, water reuse, and membrane technologies, including desalination Yu Jiang was awarded her ... critical flux helps to understand fouling and to guide the operation in theory, but difficulty appears in practical applications as (i) its value may be too low to be practically applied and (ii)...

Ngày tải lên: 02/04/2014, 15:04

... monitoring and evaluation, and anonymized prior to being made available for analysis The secondary analysis of routinely collected data is exempt from ethics review by both the Malawi National Health ... to organize special services where staff can access a professional provider in a confidential manner [11] In 2006, a national survey in Malawi calculated the human resource allocation providing ... notes from the interviews and taking out relevant parts for this evaluation All data were analyzed using SPSS version 17 (New Jersey, USA) Data were collected as part of routine programme monitoring...

Ngày tải lên: 20/06/2014, 08:20

... referred to as Pi + CaCO3 medium, contained 500 µM NaH2PO4 and g·L–1 of CaCO3 solid phase instead of CaCl2 The mineral was a reagent grade commercial product (Merck 2066) and was added to each flask ... that oxalate was always the main organic anion (> 90%) produced by the fungi studied, with minor quantities of citrate, succinate, malate and tartrate (data not shown) Measurements of total oxalate ... was measured directly above the initial plug and at 0.5 cm intervals to the edge of the dish 2.5 Statistics All results given are means and standard deviations from five replicates When indicated,...

Ngày tải lên: 08/08/2014, 01:21

... curve and iii) fitting a polynomial curve to these averaged data In the second stage, a radial growth index, expressed in percent, was calculated for each of the rings measured, including those from ... practical reasons related to field conditions and to the structure of the stands, it was not possible to obtain a sample which was balanced for all the combinations of the treatments This was also ... indicated that the corresponding lowering of the water tables was about 20 to 30 cm during very rainy periods On 18 August 1981, part of the experimental areas, drained and undrained, was chemically...

Ngày tải lên: 08/08/2014, 18:21

... patterns in inflammatory arthritis Proc Natl Acad Sci USA 1994, 91:8562-8566 Morita Y, Yamamura M, Kawashima M, Harada S, Tsuji K, Shibuya K, Maruyama K, Makino H: Flow cytometric single-cell analysis ... IL-18 in rheumatoid arthritis J Clin Invest 1999, 104:1393-1401 Yamamura M, Kawashima M, Taniai M, Yamauchi H, Tanimoto T, Kurimoto M, Morita Y, Ohmoto Y, Makino H: Interferon-gammainducing activity ... 26:1647-1651 Ahn HJ, Maruo S, Tomura M, Mu J, Hamaoka T, Nakanishi K, Clark S, Kurimoto M, Okamura H, Fujiwara H: A mechanism underlying synergy between IL-12 and IFN-gamma-inducing factor in enhanced...

Ngày tải lên: 09/08/2014, 01:23

... gas exchange data of figures and are presented in A vs C i graphs For both measurement periods and in all treatments the decline of A in response to transplanting was accompanied by increasing ... mechanisms as diverse as improving mineral absorption and assimilation affecting hormonal balance in the plant, enhancing the Plant material contact between roots and soil, and pro- tecting roots ... treatments in February er Water and nutrient status No significant alteration in wp ψ was observed after transplanting in any of the treatments and all treatments had similar values ranging...

Ngày tải lên: 09/08/2014, 03:25

... aaaaagcaggctccatggattctcaggaca TSPO NT2 aaaaagcaggctccatggccgagacagagagg TSPO NT3 aaaaagcaggctccatggcgaaacgtggtctc TSPO CT1 agaaagctgggtccgcgacagcaagctttaca TSPO CT80 agaaagctgggtcggacttagctcgattcccgta Balsemão-Pires ... RVS ACAAAGGAAAACGCGATCAAA ACTTGAGACCACGTTTCGCC GUN1 FWD GCGATTCTGAATGCTTGCAG GUN1 RVS AGGAGCCATACATTCTCTCT GUN2 FWD AGACTCCAATTTCCCAACTT GUN2 RVS TTACCAGGACGTGTTGGTTC GUN4 FWD GAAACCGCGACCATATTCGAC ... cloning and genotyping PRIMER NAME FOR GENOTYPING AND CLONING SEQUENCE AtTSPO LP agagcaaatcgcatcagcgtc AtTSPO RP ggaacgtaaccggatcccaaa LBa1 tggttcacgtagtgggccatcg TSPO NT1 aaaaagcaggctccatggattctcaggaca...

Ngày tải lên: 11/08/2014, 11:21

... continuing commitment and determination in the fight against HIV, but also the importance of future intervention research in China Lists of abbreviations ART: antiretroviral therapy; ATS: amphetamine-type-stimulants; ... research grants from the China National Key Research Program (2007BAI07B01) awarded to JL and from the US National Institutes of Health (5R21DA023893-02) awarded to HL Author details Yunnan Institute ... Ma Y, Wu Z: Campaign against drugs and control of IDU transmitted HIV/AIDS in China Zhongguo Xing Bing Ai Bing Fang Zhi 2000, 6:185 Yap L, Wu Z, Liu W, Ming XQ, Liang S: A rapid assessment and...

Ngày tải lên: 11/08/2014, 18:20

... Acknowledgements Financial assistance from the Alberta Agricultural Research Institute (AARI; NNVK) and the Natural Sciences and Engineering Research Council (NSERC) of Canada (NNVK and MKD) is gratefully acknowledged ... Zhao JW, Xiao Y, Meng JL: Identification of prior candidate genes for Sclerotinia local resistance in Brassica napus using Arabidopsis cDNA microarray and Brassica-Arabidopsis comparative mapping ... Natl Acad Sci USA 1998, 95(5):2691-2696 Mahonen AP, Bishopp A, Higuchi M, Nieminen KM, Kinoshita K, Tormakangas K, Ikeda Y, Oka A, Kakimoto T, Helariutta Y: Cytokinin signaling and its inhibitor...

Ngày tải lên: 12/08/2014, 03:20

... to the original idea, laboratory work, interpretation of data and manuscript writing AZ contributed to patient characterization, acquisition of data and statistics TS contributed to the original ... according to a standardized semiquantitative histological scoring protocol for activity and chronicity indices [31] Renal disease activity and response to therapy Renal disease activity was estimated ... induction therapy, anti-CRP appears to behave similarly to anti-dsDNA antibodies [26,37], but differently from autoantibodies to SS -A/ Ro and SS-B/La [25] and cardiolipin (unpublished data) It has been...

Ngày tải lên: 12/08/2014, 11:22

... were administered Norepinephrine infusion was adjusted to maintain MAP above 65 mmHg In patients in the norepinephrine group, a MAP above 65 mmHg was achieved by adjusting the norepinephrine dosage ... However, in a small group of patients with cardiocirculatory failure, recommended standard therapy alone is not sufficient to attain a MAP necessary to maintain perfusion of an altered microcirculation ... case report and our findings, a dramatic decrease in small vessel numbers and, ultimately, a complete standstill in sublingual capillary flow occurred In their patient, Boerma and colleagues [25]...

Ngày tải lên: 12/08/2014, 23:22

... GCGGCATTGCTG*ACACCGGC 40 GCAGGGGAAGACATAACCACCG 40 Asp f 11 AFUA_2G03720 GGTCCTAACAC*CAACGGC 40 GAGCTTCGATCTCCTTGAC 40 Asp f 12 AFUA_5G04170 TGACCAAGGCT*GATTTGATC 40 CAACAAGGTAAGCAGAGTAG 40 Asp f 13 AFUA_4G11800 ... CAATCATGATA*CCATGGTGAC 40 b-tubulin AFUA_1G10910 CGACAACGAG*GCTCTGTACG 40 CAACTTGCGCAGATCAGAGTTGAG 40 GpdA AFUA_5G01970 GGCGAGCTCAAGAACATCCTCGGCTA 20 CTTGGCGATGTAGGCGATAAGGTCGA 20 FksA AFUA_6G12400 GCTGCGCCCAAG*TCGCCAAATC ... 22 AFUA_6G06770 CATGATCGTCCCTGA*CTCCGC 40 CACCCTCGTCACCAACGTTG 40 Asp f 23 AFUA_2G11850 GCAGATTACTCC*CATGGGTG 40 GTACAGGGTCTTGCGCAG 40 Actin AFUA_6G04740 TCATCATGCGCGACAGC 10 CAATCATGATA*CCATGGTGAC...

Ngày tải lên: 13/08/2014, 13:22

... 5’GCCACCATGGCGTATAGCGGGTGGCAGCGACAGAGCCAGAATAAC-3’, antisense 5’-ATACGCCATGGTGGCGATATAATCGACGTGTTAGAAGCTTATGCA -3’ The template plasmid DNA was digested with DpnI and amplified fragment DNA was ... activating transcription factor ATF4 activating transcription factor ATF5 activating transcription factor ATF6 activating transcription factor bZIP basic zipper C/EBP CCAAT enhancer binding portein ... 5'-/5ATTCTGGCTCTGTCGCTGCCACCCGCT-3', uORF- 35 Luc sense 5'-GAAGACGCCAAAAACATAAAGAAAGGCC-3’ WT (34aa) uORF-Luc construct was used as template strand to create the ∆14-23 amino acids uORF-Luc plasmid that encodes...

Ngày tải lên: 24/08/2014, 12:32

Ngày tải lên: 14/11/2014, 07:22