Báo cáo khoa học: Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ion selectivity ppt
Báo cáo khoa học: Identification in the yeast Pichia stipitis of the first L-rhamnose-1-dehydrogenase gene docx
... Lane A contains the molecular mass markers (masses in kDa are indicated). Lane B contains the combined active fractions after the DEAE column separation. Lane C shows the protein eluted from the ... peptides of a protein with the GenBank identifier ABN68405. This protein had been annotated as a putative d-glucose-1-dehydro- genase II. The protein has 258 amino...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt
... 4991, E-mail: susan.douglas@nrc.ca Abbreviations: AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancer binding protein; d.p.h., days ... noncoding strands, respectively. AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; GATA, GATA motif; a- IFN, a- interferon; NF-IL6, nuclear fac...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx
... eukaryotic kinases where binding of an interacting protein removes the inhibitory conforma- tion of the activation loop of the kinase, leading to its phosphorylation and further stabilizing the active ... [14], a transcriptional regulator participating in the control of peptide transport and sporulation initia- tion. All three proteins (MinD, SojA and SalA) lack a tr...
Ngày tải lên: 23/03/2014, 06:20
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... STAT protein inter- action domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipper domain and fork-head domain ... GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR Zf3¢tbet-F1 CTTCTCCAGG...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... detected. An alignment of these translated carbonic anhydrase cDNAs with vertebrate and nonvertebrate carbonic anhydrase protein sequences revealed the conservation of most amino acids involved in the catalytic ... zinc-containing enzymes catalyzing the reversible hydration of CO 2 to bicarbonate. Ubiqui- tous in a wide range of eukaryotic organisms, they are also wide...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG QM protein AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A ... GGGAACCAGCAGTCGTCAAA CGTCCACTGAGAGGATGAGACA Inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein AAAGCAGAG...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... cm )1 ,at15°C. The gel was then dried and auto- radiographed. In the UV cross-linking assay, the samples were incuba- ted at room temperature, as described above for the EMSA assay, and then irradiated ... E. & Lavi, S. (1993) Replication protein A is the major single-stranded DNA binding protein detected in mammalian cell extracts by gel retardation assays and UV cr...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... that the charge repulsion between the phosphate groups in the mid- region and the one located in the C-terminal portion of the protein may cause a conformational change that makes the cleavage ... Journal compilation ª 2009 FEBS a mechanism for increasing the bioavailability of IGFs by enhancing the proteolytic cleavage as well as for producing the C-te...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... seven mutations to abolish protein phosphorylation was a result of other protein kinases masking the PKA-catalysed part. Indeed, protein kinases other than PKA, including tyrosine kinases, have been ... indicating that an additional, but weak determinant may be located distal to amino acid 411. Functional aspects of mutation of S385, S401 and T407 The effects of PKA-cata...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Identification of multiple isoforms of the cAMP-dependent protein kinase catalytic subunit in the bivalve mollusc Mytilus galloprovincialis potx
... Frac- tions of 0.5 mL were collected and assayed for protein kinase activ- ity. Three distinct peaks associated with protein kinase activity were separated: I, II and III. Aliquots of fractions ... column and eluted with a linear salt gradient. Fractions of 0.5 mL were collected and assayed for pro- tein kinase activity. Two distinct peaks associated with protein kinase activity...
Ngày tải lên: 07/03/2014, 06:20