Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca 2+ uptake and sequestration Csaba ... mitochondria isolated from embryos of A. franciscana, a phenomenon that is apparently at odds with the mammalia...
Ngày tải lên: 29/03/2014, 00:20
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... support a close spatial and functional interaction between aG lu219 and aHis245, including the f act that in the ATP synthases of mitochondria and of photosynthetic bacteria the position of these ... A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Pa...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCCA...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... repression. These results thus demon- strate a strong conservation in the binding of C-terminal binding protein- interacting domains despite great variability in their amino acid sequences. Finally, this ... cause holoprosencephaly and link NODAL signalling to human neural axis determination. Nat Genet 25, 205– 208. 37 Melhuish TA & Wotton D (2000) The interaction of th...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Deletion of Phe508 in the first nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator increases its affinity for the heat shock cognate 70 chaperone docx
... determined from each set of dose– response data by global fitting of the association and dissociation phases of all binding curves in that dataset (biaeval). The dissociation constant (K D ) for each ... B min and B max are minimum and maximum binding, respectively; and [NBD1] and [ATP] are the concentrations of NBD1 and ATP, respectively. Statistical analysis Unl...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used. Quantification of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled with [c- 32 P]ATP ... V1 signals are also observed in the unpaired regions, including one location in L1 and J1 ⁄ 2, and two in L2, indicating the presence of some sort...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... one and four residues, a1 Con a9 a1 Con a1 a9 Con a1 a9 Con a9 a9 LP-Con A B Con - TAATGTC a1 - TAATGAC brG - TGATACG nsA - TGATACA nsT - TGATACT brC - TGATACC LP -a1 Fig. 5. In uence ... suggested marginal roles for each of the four 3¢-flanking positions within the consensus sequence. Information obtained from investigations of the effects of sw...
Ngày tải lên: 29/03/2014, 08:20
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... all-trans retinal (atRAL) by a photon induces a conformation change of the visual pigments, triggers the phototransduction cascade and initiates vision [1,2]. The retinoid visual cycle Abbreviations 11cRAL, ... RPE65c was incubated with liposomes containing atRE, and the generated retinoids from the reaction were analyzed by HPLC. In the absence of a metal chel...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... ring. The c ring of I. tartaricus has 11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive charge on the stator attracts one of the negative charges ... handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same pattern as in the AFM surface re...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt
... treatment plant, and endowed with unusual metabolic capabilities for the degradation of aromatic hydrocarbons [2]. In fact, in contrast with other Pseudomonas strains, this microrganism is able to grow on ... 7.5% of the LPSs). General and analytical methods Determination of Kdo, neutral sugars, carbamoyl analysis, including the determination of the absolute...
Ngày tải lên: 19/02/2014, 13:20