Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

... sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration Csaba ... mitochondria isolated from embryos of A. franciscana, a phenomenon that is apparently atodds with the mammalian consensus.Fig. 1. Effect of ANT ligands on Ca2+ uptake capacity in Artemia mitochondria. ... mitochondria of A. franciscana and Ca2+ uptake capacity are insensi-tive to BKA. Resistance to BKA may be a direct con- sequence of the unique sequence of the Artemia ANT.ResultsEffect of adenine...

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... support a closespatial and functional interaction between aG lu219 and aHis245, including the f act that in the ATP synthases of mitochondria and of photosynthetic bacteria the position of these ... A point mutation in the ATP synthase of Rhodobacter capsulatusresults in differential contributions of DpH and Du in driving the ATP synthesis reactionPaola Turina and B. Andrea MelandriDepartment ... [34]) as a standard. The amounts of chromatophores and standard protein in the different lanes of a single gelwere kept in the linear range of the luminol assay response.Light-induced ATP synthesisLight-driven...

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢CLS ... aggregates of mismatch repairproteins MutS, MutL in relation to their interaction with mismatch containing DNA and the ongoing ATPhydrolysis. Here we have mainly used dynamic lightscattering...

Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx

... repression. These results thus demon-strate a strong conservation in the binding of C-terminal binding protein-interacting domains despite great variability in their amino acid sequences.Finally, this ... causeholoprosencephaly and link NODAL signalling to human neural axis determination. Nat Genet 25, 205–208.37 Melhuish TA & Wotton D (2000) The interaction of the carboxyl terminus-binding protein with the ... binding of a CtBP-interacting partner contain-ing a PxDLS or a GxDLS motif is mediated by the same peptide recognition cleft in the CtBP N-terminalregion.Point mutation of the only invariant...

Báo cáo khoa học: Deletion of Phe508 in the ﬁrst nucleotide-binding domain of the cystic ﬁbrosis transmembrane conductance regulator increases its afﬁnity for the heat shock cognate 70 chaperone docx

... determined from each set of dose–response data by global ﬁtting of the association and dissociation phases of all binding curves in that dataset(biaeval). The dissociation constant (KD) for each ... Bmin and Bmaxareminimum and maximum binding, respectively; and [NBD1] and [ATP] are the concentrations of NBD1 and ATP,respectively.Statistical analysisUnless otherwise stated, data are ... First, the binding and hydrolysis of ATP at the nucleotide- binding domain of Hsc70 is known to accelerate its binding and release of substrates, reducing the afﬁnity of their interaction.Once ADP...

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... SP1(tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used.Quantiﬁcation of the splicing ratio by RT-PCR wasperformed using the forward primer radiolabeled with [c-32P]ATP ... V1signals are also observed in the unpaired regions,including one location in L1 and J1 ⁄ 2, and two in L2, indicating the presence of some sort of nonca-nonical base–base or base–backbone interactioninside ... Zhang laboratory for cooperation and discussion during the course of this investigation.This work was supported by the China 863 program(2007AA02Z112) and National Natural Science Foun-dation...

Báo cáo khoa học: Autoregulatory binding sites in the zebraﬁsh six3a promoter region deﬁne a new recognition sequence for Six3 proteins potx

... one and four residues, a1 Con a9 a1 Con a1 a9 Con a1 a9 Con a9 a9 LP-Con A BCon - TAATGTC a1 - TAATGAC brG - TGATACGnsA - TGATACA nsT - TGATACT brC - TGATACC LP -a1 Fig. 5. In uence ... suggested marginalroles for each of the four 3¢-ﬂanking positions within the consensus sequence. Information obtained from investigations of the effects of swapping ﬂankingregions with sequences from ... six 3a overexpression in vivo.Relative in uence of ATTA core ﬂanking nucleotides on Six 3a HD binding To analyse the contribution of individual ﬂanking nucleotides and their importance relative to...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... all-trans retinal (atRAL)by a photon induces a conformation change of the visual pigments, triggers the phototransduction cascade and initiates vision [1,2]. The retinoid visual cycleAbbreviations11cRAL, ... RPE65cwas incubated with liposomes containing atRE, and the generated retinoids from the reaction were analyzed byHPLC. In the absence of a metal chelator, RPE65c cat-alyzed the production of 11cROL ... system (AlphaIn-notech, San Leandro, CA, USA). The bands (inten-sity · area) were semi-quantiﬁed by densitometry usingALPHAVIEW Q software (AlphaInnotech), and averaged from at least three independent...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... ring. The c ring of I. tartaricus has11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive charge on the stator attracts one of the negative charges ... handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same patternas in the AFM surface representation of Fig. 2A. Bycomparison with the 3D ... of the ion-binding site. Therefore, the c ring of A. woodii hasonly 10 membrane-buried negative charges that areessential for binding the ion and also for the rotationalmechanism of the ring....

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

... treatmentplant, and endowed with unusual metabolic capabilities for the degradation of aromatic hydrocarbons [2]. In fact, in contrast with other Pseudomonas strains, this microrganism is able to grow on ... 7.5% of the LPSs).General and analytical methodsDetermination of Kdo, neutral sugars, carbamoyl analysis,including the determination of the absolute conﬁguration of the heptose residues, organic ... conclusion, the data above allowed the identiﬁcation of the carbohydrate backbone from alkaline degradation of the rough form LPS from P. stutzeri OX1.Isolation, NMR and MS analyses of oligosaccharide...

Xem thêm