Báo cáo khoa học: ATP N-glycosidase A novel ATP-converting a

Báo cáo khoa học: "Generating parallel multilingual LFG-TAG grammars from a MetaGrammar" docx

... traditional hand-crafted grammars. A third and essential advantage is that it is straightforward to obtain from a single hierarchy parallel multi-lingual grammars similar to the parallel LFG grammars ... Pennsylvania kinyon@linc.cis.upenn.edu Abstract We introduce a MetaGrammar, which al- lows us to automatically generate, from a single and compact MetaGrammar hierarchy, paral...

Ngày tải lên : 23/03/2014, 19:20

8
297
0

Báo cáo khoa học: ATP N-glycosidase A novel ATP-converting activity from a marine sponge Axinella polypoides potx

... T. Reintamm et al. (Eur. J. Biochem. 270) Ó FEBS 2003 ATP N-glycosidase A novel ATP- converting activity from a marine sponge Axinella polypoides To ˜ nu Reintamm, Annika Lopp, Anne Kuusksalu, To ˜ nis ... of ATP N-glycosidase activity was also observed when the sponge was treated with trichloro- acetic acid. ATP N-glycosidase from A. polypoides is capa...

Ngày tải lên : 23/03/2014, 21:20

11
366
0

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan). Culture and screening of bacteria Bacterial strains were cultivated for 15–20 h at 30 ... (5¢-GGAAT TCCATATGTCCGCACCTTCCACCAGCACCG-3¢ and 5¢-GGGAAGCTTTCAGCCAAGCAGCTCTTTCAGG-3¢), 2.5 U LA Taq DNA polymerase, and 115 ng genomic DNA from P. putida ATCC12633: preincubation at 94 °C fo...

Ngày tải lên : 19/02/2014, 16:20

7
518
0

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... Experimental procedures DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New ... K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kag...

Ngày tải lên : 06/03/2014, 09:22

13
446
0

Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx

... contain an aliquot from the anti-PU1 a nity chromatography purification step; lanes 2 and 4 contain an aliquot from the hydroxylapatite purification step; lanes 1 and 2, silver-stained; lanes 3 and ... lysates by sequential chromatography on DEAE, anti-(Ubi-L) Ig–conjugated Sepharose, and hydroxylapatite. MALDI-TOF-MS fingerprinting revealed that this Ubi-L adduct consists of an 8.5 kDa Ubi...

Ngày tải lên : 17/03/2014, 10:20

7
272
0

Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiﬂorus pot

... approximately 50 kDa, a second peak of 30 kDa and a third peak of about 20 kDa. A similar gel ﬁltration experiment was also carried out for the complex of XAIP with a- amylase. A mixture of XAIP and a- amylase ... interaction with a- amylase. Abbreviations BASI, barley a- amylase ⁄ subtilisin inhibitor; Con-B, concanavalin-B; GH, glycosyl hydrolase; TIM, triosephosphate isomerase;...

Ngày tải lên : 29/03/2014, 09:20

15
399
0

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... than that for keratan sulfate, indicating that 2 is very suitable as a sensitive substrate for analytical use in an endo-b-galactosidase assay. Compound 1 still acts as a fairly good substrate ... Sci. USA 75, 2315–2319. 33. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S. & Kobata, A. (1984) Comparative study of the oligosaccharides released from baby hamster kidney cells...

Ngày tải lên : 31/03/2014, 07:20

11
365
0

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... you please elaborate on that specific situa- tion?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a qualitative method to use empiric data (e.g., interview) ... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment...

Ngày tải lên : 25/10/2012, 10:45

10
587
0

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interactions....

Ngày tải lên : 15/02/2014, 01:20

8
740
0

Tài liệu Báo cáo khoa học: Puriﬁed RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... research award from JDRF, a grant from ADA, and a research grant from OCAST HR07-067. References 1 Baylor D (1996) How photons start vision. Proc Natl Acad Sci USA 93, 560–565. 2 McBee JK, Palczewski ... measured for total cell lysates (4) and Chaps-soluble fractions ( ) and plotted. The activity was calculated from the peak areas of the generated 11-cis-retinol in HPLC proﬁles...

Ngày tải lên : 18/02/2014, 08:20

11
587
0