Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

... amphibian antimicrobial peptides (Eur. J. Biochem. 270) 2081 Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide ... reconstruction shows that the gene family encoding antimicrobial peptides from South American and Australian hylids and from Indian, Eura...

Ngày tải lên: 23/03/2014, 17:21

14 306 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and Satoshi H. Namekawa Department of Applied ... acids) and ED (glutamate/aspartate- rich; 522–578 amino acids) domains in CcCac1L are conserved amongst human and S. cerevisiae homo- logues (Fig. 1A) . The KER and ED...

Ngày tải lên: 07/03/2014, 05:20

10 487 0
Báo cáo khóa học: Antimicrobial activities of heparin-binding peptides pdf

Báo cáo khóa học: Antimicrobial activities of heparin-binding peptides pdf

... AKKARAAKKARAAKKARAAKKARA 12.5 [15,20] AKK18 AKKARAAKKARAAKKARA 12.3 [15,20] AKK12 AKKARAAKKARA 12.0 [15,20] AKK6 AKKARA 11.2 [15,20] ARK24 ARKKAAKAARKKAAKAARKKAAKA 12.3 [15,20] ARK16 ARKKAAKAARKKAAKA ... or ARKKAAKA [15,20] were synthesized and tested in bactericidal assays using E. faecalis as the test organism, and the results demonstrate that these peptides are also antibacterial. A...

Ngày tải lên: 07/03/2014, 15:20

8 353 0
Báo cáo khoa học: Antimicrobial activity of histones from hemocytes of the Pacific white shrimp ppt

Báo cáo khoa học: Antimicrobial activity of histones from hemocytes of the Pacific white shrimp ppt

... domain of histone H 2A: buforin I (39 amino acids), parasin I (21 amino acids), and hipposin (51 amino acids ) from the Asian toad stomach and catfish and halibut skin mucus, respect- ively, have ... [11], and in several penaeid shrimp. I n penaeid shrimp, the most studied family of antimicrobial peptides is the penaeidins. These peptides range from 5.5 to 6.6 kDa and are...

Ngày tải lên: 07/03/2014, 16:20

9 373 0
Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

... Lys33GP was constructed by the SOE- PCR strategy, using primer 1 (5¢-GTGAATTC CTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer 2 (5¢-GTCTCGAGTTACAGGCGAATATCG GCGCAATGGCACTGCGGCGGAATGCTTTTGGTGC AGCGGCTGCTATCGCAGCTCGG-3¢). ... ZORBAX 300 SB-C18 semiprepar- ative column was from Agilent Technologies (Santa Clara, CA, USA). Trifluoroacetic acid (TFA) a...

Ngày tải lên: 15/03/2014, 09:20

9 409 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx

... misregulations. In fact, a combi- natorial therapy targeting histone deacetylases and DNA methyltransferases has been shown to have a synergistic role in gene regulation, and clinical trials have ... colorec- tal cancer, liver, breast and cervical cancers; and the demethylase, LSD1, is overexpressed in prostate can- cer. The implication of HMTs and demethylases in cancer and h...

Ngày tải lên: 16/02/2014, 14:20

17 665 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... histones H3 and H4) displayed potent bacterici- dal activity mainly against Gram-negative bacteria, an effect that was amplified by acid media, whereas a lysine-rich preparation (fraction A: a mixture ... H4-(86–102) was A BC DE Fig. 1. Structures of HN and related peptides and nonpeptides. (A) Amino acid sequences of naturally occurring HN-like peptides. (B) Theo- retical amph...

Ngày tải lên: 18/02/2014, 14:20

12 756 0
Tài liệu Báo cáo khoa học: Cosubstrate-induced dynamics of D-3-hydroxybutyrate dehydrogenase from Pseudomonas putida ppt

Tài liệu Báo cáo khoa học: Cosubstrate-induced dynamics of D-3-hydroxybutyrate dehydrogenase from Pseudomonas putida ppt

... important function for substrate binding has been demonstrated for a Gln91Ala mutant with K m 51 mm and k cat 411Æs )1 and for a Lys149Ala mutant that was essentially inactive [9]. His141 appears ... calculate the principal axes of the translation and libration tensors. The quality of the models was assessed with Ramachandran plots using the program procheck [26]. K. S. Paithank...

Ngày tải lên: 18/02/2014, 16:20

13 532 0
Tài liệu Báo cáo khoa học: Relationships between structure, function and stability for pyridoxal 5¢-phosphate-dependent starch phosphorylase from Corynebacterium callunaeas revealed by reversible cofactor dissociation studies doc

Tài liệu Báo cáo khoa học: Relationships between structure, function and stability for pyridoxal 5¢-phosphate-dependent starch phosphorylase from Corynebacterium callunaeas revealed by reversible cofactor dissociation studies doc

... phos- phate concentration and results from interactions with the oxyanion that are specific to the quarternary state. Arg234fiAla and Arg242fiAla mutants showed, respect- ively, eight- and > ... Except for R22 6A and R24 2A mutants (Table 1), all enzymes were stable for 2 h in the presence of 5 m M potassium phosphate and potassium sulphate. Reconstitutions with PLP of apo-...

Ngày tải lên: 19/02/2014, 16:20

11 636 0
Tài liệu Báo cáo khoa học: Complete subunit sequences, structure and evolution of the 6 · 6-mer hemocyanin from the common house centipede, Scutigera coleoptrata pptx

Tài liệu Báo cáo khoa học: Complete subunit sequences, structure and evolution of the 6 · 6-mer hemocyanin from the common house centipede, Scutigera coleoptrata pptx

... untranslated regions and the entire 3¢ untranslated regions. The standard polyadenylation signals (AATAAA) and the poly (A) -tails of different lengths are present in each clone. The open reading frames of ... including the signal peptide but molecular mass and pI are calculated without the signal peptide. Subunit Accession number cDNA (bp) Protein (amino acids) Molecular mass...

Ngày tải lên: 20/02/2014, 11:20

9 553 0
w