0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

... domain of oxaloacetate decarboxylase FEBS Journal 272 (2005) 846–855 ª 2005 FEBS 855 Identification of a domain in the a- subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex ... a- subunit contains the carb-oxyltransferase domain in its N-terminal portion and the biotin-binding domain in its C-terminal portion. The c-subunit plays a profound role in the assembly of the complex. ... D20–D140. The corresponding numbersindicate deletions from the C terminus of a- 2 or the number of remaining amino acids of a- 2-C.P. Dahinden et al. Association domain of oxaloacetate decarboxylase FEBS...
  • 10
  • 333
  • 0
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

... OLF.Ouabain-sensitive and -insensitive a- isoforms of Na+/K+-ATPase in ratsAll isoforms of the catalytic a- peptide of Na+/K+-ATPasehave similar, high affinity for ouabain [17] with Kd in the order ... by another group in collaboration with Hamlyn [21] by means of two independ-ent assays, a radioimmunoassay using an anti-ouabain Igand an enzymatic assay using ouabain-sensitive Na+/K+-ATPase ... isoforms, of which the latter may have a sublocalization critical for the observations looking atouabain as a signal-transducer.Experiments pointing to a pivotal role of ouabain in signal-transductionIn...
  • 4
  • 423
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain that isrequired for the oncogenic ... characteristics of protein arginine methyltransferase 1 and 3 toward the Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin ... (RGG) domain of the C-terminal in EWS binds to the G-richsingle-stranded DNA and RNA fold in the G-quadruplex structure.Furthermore, inhibition of DNA polymerase on a template containing a human...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an ... studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin antisense) [19] Identification of M. catarrhalis lpxX and lpxL S. Gao et al.5206 FEBS Journal ... staining analysis with revert-ant O35ElpxX or O35ElpxL showed that an LOS bandmigrated in a manner identical to that of the parentalLOS. The LOS band of revertant O35ElpxX alsoshowed a change...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... zinc-containing enzymes catalyzing the reversible hydration of CO2to bicarbonate. Ubiqui-tous in a wide range of eukaryotic organisms, they arealso widespread in the Archaea and Bacteria domains[11]. ... reticulum area around the nucleus and is maxi-mal in the cytoplasmic apex of the branchial epidermis.By contrast, the staining is very weak basally along the myoepithelium that lines the internal ... amino acid (leucine)instead of the histidine that is shared by almost allother sequences. The same amino acid replacementoccurs in the two isoforms CAa and CAb of Droso-phila melanogaster.Phylogenetic...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of thisprotein, we revealed that the aggregate also contains the inner ear-specific collagen otolin-1 ... calcium-binding domain of the protein. (A) Schematic drawing of the recombinant proteins. SixGST-fused recombinant proteins containing the three distinctivedomains of tandem repeat 1 (R1), the Glu-rich ... However, most of these proteinbands disappeared after 30 min of treatment, indicat-ing that these proteins are damaged by long incubation with TFMS. On the other hand, heparitinase II wasable to...
  • 12
  • 568
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA...
  • 13
  • 563
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and itsC-terminal extension. (B) Alignment of ligandbinding domain ... controlled by binding of the Gal4 DNA binding domain (GAL4DB) to the GAL4 response elements. When a GAL4BDfusion protein contains an activation domain, it will transactivate the expression of the reporter ... motifs binding to the cis-regulatory region of a target gene, and a conserved ligand-binding domain (LBD) that is involved in transcriptional activation of the target gene via ligand and coregulator...
  • 16
  • 542
  • 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... Nucleotide change LocationK223E AAGfiGAG In front of the N-terminal regulatory domain Q227R CAGfiCGG Within the N-terminal regulatory domain T23 1A ACAfiGCA Within the N-terminal regulatory domain P232S ... osmoregulation. The discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembranetransport [1]. Aquaporins and aquaglyceroporins [the majorintrinsic protein ... previously characterized N-terminal regulatory domain and two mutations are located within the approachto the first transmembrane domain. Three mutations causetruncation of the C-terminus, confirming...
  • 9
  • 383
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... Identification of NF1 as a silencer protein of the human adeninenucleotide translocase-2 genePeter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2and B. Dean Nelson11Department ... translocase(ANT) are expressed in mammalian cells. Both catalyse the exchange of mitochondrial ATP for cytosolic ADP, therebyplaying key roles in maintaining the cytosolic phosphory-lation potential, ... autoradiographed. Competitor DNAsused in EMSA analysis were: NF1 wt, 5¢-TTTTGGATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTTGGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGTCTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTTTGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAATGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt,5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut,5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢.Chromatin...
  • 8
  • 426
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ