Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... domain of oxaloacetate decarboxylase FEBS Journal 272 (2005) 846–855 ª 2005 FEBS 855 Identification of a domain in the a- subunit of the oxaloacetate decarboxylase Na + pump that accomplishes complex ... a- subunit contains the carb- oxyltransferase domain in its N-terminal portion and the biotin-binding domain in its C-terminal portion. The...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx
... OLF. Ouabain-sensitive and -insensitive a- isoforms of Na + /K + -ATPase in rats All isoforms of the catalytic a- peptide of Na + /K + -ATPase have similar, high affinity for ouabain [17] with K d in the order ... by another group in collaboration with Hamlyn [21] by means of two independ- ent assays, a radioimmunoassay using an anti-ouabain Ig and an enzymatic assay...
Ngày tải lên: 23/03/2014, 17:21
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain that is required for the oncogenic ... characteristics of protein arginine methyltransferase 1 and 3 toward the Ewing sarcoma protein and a peptide. Proteins 61, 164–175. 48 Raman B, Guarnaccia C, Na...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc
... Catlin BW (1990) Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 3, 293–320. 2 Karalus R & Campagnari A (2000) Moraxella catarrh- alis: a review of an ... study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin antisense) [19] Identification of M. catarrhalis lpxX and lpxL S. Gao et al. 5206 FE...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... zinc-containing enzymes catalyzing the reversible hydration of CO 2 to bicarbonate. Ubiqui- tous in a wide range of eukaryotic organisms, they are also widespread in the Archaea and Bacteria domains [11]. ... reticulum area around the nucleus and is maxi- mal in the cytoplasmic apex of the branchial epidermis. By contrast, the staining is very weak basally along the...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... macromolecule-64 (OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains the inner ear-specific collagen otolin-1 ... calcium-binding domain of the protein. (A) Schematic drawing of the recombinant proteins. Six GST-fused recombinant proteins containing the three di...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢) Size (bp) MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178 MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246 BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGT...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding domain ... controlled by binding of the Gal4 DNA binding domain (GAL4DB) to the GAL4 response elements. When a GAL4BD fusion protein contains an activation domain, it will transact...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... Nucleotide change Location K223E AAGfiGAG In front of the N-terminal regulatory domain Q227R CAGfiCGG Within the N-terminal regulatory domain T23 1A ACAfiGCA Within the N-terminal regulatory domain P232S ... osmoregulation. The discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembrane transport [1]. Aquaporins and aquagl...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene Peter Barath 1,2 , Daniela Poliakova 1,2 , Katarina Luciakova 1,2 and B. Dean Nelson 1 1 Department ... translocase (ANT) are expressed in mammalian cells. Both catalyse the exchange of mitochondrial ATP for cytosolic ADP, thereby playing key roles in maintaining the cytosolic pho...
Ngày tải lên: 07/03/2014, 15:20