Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf
... the purification and partial characterization of a putative microtubule-associated protein (MAP) from bovine adrenal cor- tex with an approximate molecular mass of 250 kDa. The protein was expressed ... 5, bovine adrenal gland ferritin; and lanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al. 824 FEBS Journal 27...
Ngày tải lên: 23/03/2014, 13:20
... C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA ... used as probes are indicated above each lane. The DNA protein complexes were resolved by 6% PAGE and visu- alized by autoradiography. K. Takahama et al. Identification of Ewing’s sarcoma...
Ngày tải lên: 15/02/2014, 01:20
... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... viable bacteria was 100 CFU per lung. Clearance of M. catarrhalis was expressed as the percentage of bacterial CFU at each time point as compared with the number at time zero. Statisti...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... region was decreased and a new band was detected at 64 kDa, but only after treatment with heparitinase II (Fig. 5A) . Although the same band was obtained after digestion Fig. 3. 45 Ca overlay analysis ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragon...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢) Size (bp) MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178 MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246 BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGT...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... Sweden; 3 Swansea Clinical School, University of Wales Swansea, UK; 4 School of Life and Health Sciences, Aston University, Birmingham, UK Aquaporins and aquaglyceroporins mediate the transport of waterandsolutesacrossbiologicalmembranes.Saccharo- myces ... family] have been found in archea, eubacteria, fungi, plants, animals and human [2,3]. Aqua- porins facilitate the diffusion of w...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin ... Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... 1000 (Table 1). Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharide consistent with a composition ... (1075), an additional phosphate group and an additional PEtn moiety (1155) and one additional phosphate group and two additional PEtn moieties (1278). Relative intensity of eac...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafficking of GABA A receptors to the plasma membrane [2,3]. Keywords calreticulin; GABA A receptor; GABARAP; phage ... association and dissociation rates were fitted as global parameters, whereas the maxi- mum response R max was fitted as a separate parameter for each binding sensorgram. The...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Identification of RNase HII from psychrotrophic bacterium, Shewanella sp. SIB1 as a high-activity type RNase H pot
... Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) Stabilization of Escherichia coli ribonuclease H by introduction of an artificial ... [10]. Bacterial RNases HI, eukaryotic RNases H1, and retroviral RNases H are members of the type 1 RNase H family. Bacterial RNases HII, bacterial RNases HIII, archaeal RNases HII, and eukaryo...
Ngày tải lên: 16/03/2014, 13:20