Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

... 2799 Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNA Ser Vlatka Godinic 1 , Marko Mocibob 1 , Sanda ... USA Accurate aminoacylation of tRNA by aminoacyl-tRNA synthetases (aaRSs) is a crucial step in the faithful translation of mRNA. In addition to their f...

Ngày tải lên: 23/03/2014, 09:20

... template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The ... (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGA...

Ngày tải lên: 07/03/2014, 16:20

... unigrams and bigrams whose frequency is larger than 2 in the training set. This list of word unigrams and bigrams are then used as a unigram-dictionary and a bigram-dictionary to generate word-based ... unigram and bigram features. The word-based features are indicator functions that fire when the local character sequence matches a word unigram or bigram occurred in the...

Ngày tải lên: 23/03/2014, 14:20

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... that the ances- tral forms of zebrafish RPE65c and 13cIMH were gen- erated by gene duplication before the divergence of the ancestral amphibian, a...

Ngày tải lên: 14/02/2014, 14:20

... combination of expression plasmids of HA–Rac1L61, HA– Rac1bWT, HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation of Rac1L61 and Rac1b (right panel). Proteasomal degra- dation was assessed ... persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several Rac1 downstream signaling path- ways [27,28]. To evaluate the...

Ngày tải lên: 18/02/2014, 16:20

... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteins are assembled in the bacterial outer membrane in a process mediated ... membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, rather than b-barrels. These proteins are usually predicted to ha...

Ngày tải lên: 19/02/2014, 07:20

... quenched-flow analysis reveals that ChlH dramat- ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... [15–20]. As MgP is also the product of the magnesium chelatase reaction, this emphasizes the importance of quantita- tive studies not only of the...

Ngày tải lên: 20/02/2014, 02:21

... as in [23]. The coding region of AeaAQP was amplified from the pSPORT-AeaAQP by PCR using two primers: AeapS1F, 5¢-GGAAGATCTATGACTGAAAGCG CA-3¢; AeapS1R, 5¢-GGAAGATCTTTAAAAATCGTA AGATTCC-3¢. The ... functional co-ordination of the Malpighian tubules and the tracheoles supplying them. Each of the 11 mammalian aquaporins has a characteristic subcellular localization and t...

Ngày tải lên: 20/02/2014, 23:20

... terminal operators prefer natural language because they are already familiar with it, and that it gives the terminal operator the great- est power and flexibility. After all , they argue, ... one-to-one/one-to-many/many-to-many relationships, set theory, boolean algebra, or predicate calculus and the proper no~atlon may he of great assis- tance in formulating queries. Ma...

Ngày tải lên: 21/02/2014, 20:20

... vector The gene coding for Lys33GP was constructed by the SOE- PCR strategy, using primer 1 (5¢-GTGAATTC CTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer ... (GeneBank accession number AY713305) by using 3¢-RACE and 5¢-RACE (Fig. 1). The 591 bp full-length cDNA includes a 3¢-UTR and two polyA signals (AATAAA) located upstream of the p...

Ngày tải lên: 15/03/2014, 09:20