Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

... 2799 Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNA Ser Vlatka Godinic 1 , Marko Mocibob 1 , Sanda ... USA Accurate aminoacylation of tRNA by aminoacyl-tRNA synthetases (aaRSs) is a crucial step in the faithful translation of mRNA. In addition to their f...

Ngày tải lên: 23/03/2014, 09:20

12 406 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The ... (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGA...

Ngày tải lên: 07/03/2014, 16:20

9 393 0
Báo cáo khoa học: "Fast Online Training with Frequency-Adaptive Learning Rates for Chinese Word Segmentation and New Word Detection" docx

Báo cáo khoa học: "Fast Online Training with Frequency-Adaptive Learning Rates for Chinese Word Segmentation and New Word Detection" docx

... unigrams and bigrams whose frequency is larger than 2 in the training set. This list of word unigrams and bigrams are then used as a unigram-dictionary and a bigram-dictionary to generate word-based ... unigram and bigram features. The word-based features are indicator functions that fire when the local character sequence matches a word unigram or bigram occurred in the...

Ngày tải lên: 23/03/2014, 14:20

10 551 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... that the ances- tral forms of zebrafish RPE65c and 13cIMH were gen- erated by gene duplication before the divergence of the ancestral amphibian, a...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... combination of expression plasmids of HA–Rac1L61, HA– Rac1bWT, HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation of Rac1L61 and Rac1b (right panel). Proteasomal degra- dation was assessed ... persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several Rac1 downstream signaling path- ways [27,28]. To evaluate the...

Ngày tải lên: 18/02/2014, 16:20

11 470 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteins are assembled in the bacterial outer membrane in a process mediated ... membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, rather than b-barrels. These proteins are usually predicted to ha...

Ngày tải lên: 19/02/2014, 07:20

9 554 0
Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

... quenched-flow analysis reveals that ChlH dramat- ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... [15–20]. As MgP is also the product of the magnesium chelatase reaction, this emphasizes the importance of quantita- tive studies not only of the...

Ngày tải lên: 20/02/2014, 02:21

8 614 0
Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx

Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx

... as in [23]. The coding region of AeaAQP was amplified from the pSPORT-AeaAQP by PCR using two primers: AeapS1F, 5¢-GGAAGATCTATGACTGAAAGCG CA-3¢; AeapS1R, 5¢-GGAAGATCTTTAAAAATCGTA AGATTCC-3¢. The ... functional co-ordination of the Malpighian tubules and the tracheoles supplying them. Each of the 11 mammalian aquaporins has a characteristic subcellular localization and t...

Ngày tải lên: 20/02/2014, 23:20

8 424 0
Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc

Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc

... terminal operators prefer natural language because they are already familiar with it, and that it gives the terminal operator the great- est power and flexibility. After all , they argue, ... one-to-one/one-to-many/many-to-many relationships, set theory, boolean algebra, or predicate calculus and the proper no~atlon may he of great assis- tance in formulating queries. Ma...

Ngày tải lên: 21/02/2014, 20:20

4 364 0
Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

... vector The gene coding for Lys33GP was constructed by the SOE- PCR strategy, using primer 1 (5¢-GTGAATTC CTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer ... (GeneBank accession number AY713305) by using 3¢-RACE and 5¢-RACE (Fig. 1). The 591 bp full-length cDNA includes a 3¢-UTR and two polyA signals (AATAAA) located upstream of the p...

Ngày tải lên: 15/03/2014, 09:20

9 409 0
Từ khóa:
w