0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

... 2799 Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASerVlatka Godinic1, Marko Mocibob1, Sanda ... USAAccurate aminoacylation of tRNA by aminoacyl-tRNAsynthetases (aaRSs) is a crucial step in the faithfultranslation of mRNA. In addition to their fundamentalrole in translation, aaRSs are ... the formation of a specific ternary complex with seryl-tRNA synthetase and tRNASer, strengthening the interaction of seryl-tRNA synthetase with its cognate tRNASer.AbbreviationsaaRS, aminocyl-tRNA...
  • 12
  • 406
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... template and the primersRRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGAAGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGCTTGATGTAATC-3¢, BamHI site underlined). The ... (5¢-ACGCGGATCCAGTCATAAACAGCGGTTGC-3¢, Bam HI site un derlined),87SufI-BamHI-rv (5 ¢-ACGCGGATCCAACATCGTCGCCCTTCCA-3¢, BamHI site underlined) and SufIHA-XbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCATAGTCAGGAACATCGTATGGGTAGCCGCCTGGCGGTACCGGATTGACCAAC- ... translocation (Tat)-mediated protein trans-port across the bacterial cytoplasmic membrane occurs onlyafter synthesis and folding of the substrate protein thatcontains a signal peptide with a characteristic...
  • 9
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Fast Online Training with Frequency-Adaptive Learning Rates for Chinese Word Segmentation and New Word Detection" docx

... unigrams and bigramswhose frequency is larger than 2 in the training set.This list of word unigrams and bigrams are then usedas a unigram-dictionary and a bigram-dictionary togenerate word-based ... unigram and bigram features. The word-based features are indicator functions thatfire when the local character sequence matches a word unigram or bigram occurred in the trainingdata. The word-based ... are the upper and lower bounds of a scalar, with 0 < β < α < 1. As we can see, a feature with higher frequency corresponds to a smaller scalar via linear approximation. Finally, the learning...
  • 10
  • 551
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... that the ances-tral forms of zebrafish RPE65c and 13cIMH were gen-erated by gene duplication before the divergence of the ancestral amphibian, and the divergence of RPE65c and 13cIMH may have ... CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... combination of expression plasmids of HA–Rac1L61, HA–Rac1bWT, HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation of Rac1L61 and Rac1b (right panel). Proteasomal degra-dation was assessed ... persistently activated and associated with plasma membrane, Rac1b has an impaired abilityto activate several Rac1 downstream signaling path-ways [27,28]. To evaluate the possible effects of acti-vating ... codons AAA and AAG by the arginine codons AGA and AGG respectively.Rac1L61G189 was obtained by mutation of the cysteinecodon TGC into the glycine codon GGC. In all cases, the absence of additional...
  • 11
  • 469
  • 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteinsare assembled in the bacterial outer membrane in a process mediated ... membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These proteins are usually predicted to have a single a- helicaltransmembrane ... compilation ª 2006 FEBS and alkali extraction might not always be a reliableindicator of whether a protein is integral in the outermembrane [17,20–22].As a distinct means to separate integral and...
  • 9
  • 554
  • 0
Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

Tài liệu Báo cáo khoa học: Kinetic basis for linking the first two enzymes of chlorophyll biosynthesis doc

... quenched-flow analysis reveals that ChlH dramat-ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... [15–20]. AsMgP is also the product of the magnesium chelatasereaction, this emphasizes the importance of quantita-tive studies not only of the methyltransferase and chelatase, but also of the interaction ... curve. The maximumrate during an assay was taken as the steady-state rate and occurred at the beginning of the reaction.Quenched-flow measurementsPre-steady state time samples from ChlM-catalysed...
  • 8
  • 614
  • 0
Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx

Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx

... as in [23]. The coding region of AeaAQP was amplified from the pSPORT-AeaAQP byPCR using two primers:AeapS1F, 5¢-GGAAGATCTATGACTGAAAGCGCA-3¢; AeapS1R, 5¢-GGAAGATCTTTAAAAATCGTAAGATTCC-3¢. The ... functional co-ordination of the Malpighian tubules and the tracheoles supplying them.Each of the 11 mammalian aquaporins has a characteristicsubcellular localization and tissue expression pattern ... homopteran, is also organizedas a tetramer in the membrane where it forms a regular2D array [20,21]. The cloning from a Malpighian tubule cDNA library and the in situ localization of an aquaporin,...
  • 8
  • 423
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "NATURAL VS. PRECISE CONCISE LANGUAGES FOR HUMAN OPERATION OF COMPUTERS: RESEARCH ISSUES AND EXPERIMENTAL APPROACHES" doc

... terminal operators prefer natural language because they are already familiar with it, and that it gives the terminal operator the great- est power and flexibility. After all , they argue, ... one-to-one/one-to-many/many-to-many relationships, set theory, boolean algebra, or predicate calculus and the proper no~atlon may he of great assis- tance in formulating queries. Mathematicians (and musicians, ... solved as well as human capacities. If the goal is to provide an appealing interface for airline reservations, hank transactions, database retrieval, or mathematical problem solving, then the...
  • 4
  • 363
  • 0
Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

... vector The gene coding for Lys33GP was constructed by the SOE-PCR strategy, using primer 1 (5¢-GTGAATTCCTGGAAGTTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAGCGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer ... (GeneBankaccession number AY713305) by using 3¢-RACE and 5¢-RACE (Fig. 1). The 591 bp full-length cDNAincludes a 3¢-UTR and two polyA signals (AATAAA)located upstream of the polyA tail. The ... N-terminalsequence (IPPQCH) of BBI, was paired with the abridgeduniversal amplification primer. The 3¢-end partial cDNA of BBI was then amplified by PCR. The PCR product contain-ing a polyA tail was...
  • 9
  • 409
  • 0

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ