Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA ... Table 2. Primers used for mutagenesis.PrimerSequence(5¢-to3¢) Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCG Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 ... Vta1p and Vps46 p regulate the membraneassociation and ATPase activity of Vps4p at the yeast multivesicular body. Proc Natl Acad Sci USA 103,6202–6207.41 Amerik AY, Nowak J, Swaminathan S &...

Báo cáo khoa học: Hepatocyte-speciﬁc interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc

... TTCTTAAAACTTGACCAAAPrimer 2 GGGTACGATGACTAAATGATCGGAPrimer 3(Figs 3 and 5A, B)TCATCAGCAGCCCTTCTTTGCACAACPrimer 3(Figs 4 and 5C)GACTAAATGATCGGATACGTGCCCATTCTLower strandPrimer 1 CTCAACGTCATTCTAAAGTPrimer ... CTCAACGTCATTCTAAAGTPrimer 2 ACAACATACTTCGAAACTGTGACCPrimer 3 TGTCCTGGCACATGACCCGGATCATranscription factors at the CPS GRU M. Hoogenkamp et al.44 FEBS Journal 274 (2007) 37–45 ª 2006 The Authors Journal ... evidence that the transcription activation domains of GR play a keyrole in transcriptional activation mediated by a GRU,as we show that it is the only DNA-binding protein of the triad GR, FoxA and...

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... Petersburg,FL, USA) followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated ... that Gup1 has some functionrelated to the post-translational modiﬁcation of the mammalian hedgehog family, although it may have noacyltransferase activity. In this work we examinedwhether mammalian...

Tài liệu Báo cáo khoa học: "Word representations: A simple and general method for semi-supervised learning" doc

... is the size of the vocabulary and K is the number of clusters. The hierarchical nature of the clustering meansthat we can choose the word class at severallevels in the hierarchy, which can ... fast, testing is still expensive when the size of the vocabulary is large. Instead of cross-validatingusing the log-rank over the validation data asthey do, we instead used the moving average ... for what tasks? Should we prefer certainword features? Can we combine them? A word representation is a mathematical objectassociated with each word, often a vector. Eachdimension’s value corresponds...

Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

... annotatedinstances. In contrast, our study focused on a se-lect group of nominal predicates, each associatedwith a large number of annotated instances.3 Data annotation and analysis3.1 Data annotationImplicit ... undergraduate assistant’s annota-tions against the evaluation data. Our assistantachieved an overall F1score of 58.4% using the same candidate window as the baseline and dis-criminative models. ... Morristown, NJ, USA. Association for Com-putational Linguistics.Patrick Pantel and Deepak Ravichandran. 2004.Automatically labeling semantic classes. InDaniel Marcu Susan Dumais and Salim Roukos,...

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... encompasses linguistic servicesthat are being developed, in all or part, and main-tained at the University of Lisbon, Department of Informatics, by the NLX-Natural Language andSpeech Group. At ... demonstrat-ing a range of language technology toolsand at fostering the education, researchand development in natural language sci-ence and technology.1 IntroductionThis paper is aimed at supporting ... inﬂection feature val-ues, are displayed. Now, any of these lemmas canalso be clicked on, which will activate back the LX-Conjugator and will make the correspondingconjugation table to be displayed.62.4...

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... gagt … tcac ag GGATAT 1.83105 CAACAG gt aata … ttcc ag ACGTAT 7.74262 a TACTTG gt atgt … aatc ag GATATG 1.35120 a ACAGAG gt aaaa … tctc ag AAAATT 9.96 138 GCATTG gt aagg … attt ag GGCAGT ... 1024AAGGAC gt aagt … ttca ag GATTGC 0.5711176 AGAAGA gt aagt … ttgc ag CAATTT 4.512130 ATGTTG gt gagt … tttt ag GGCATA 3.91385 ACTCAA gt aagg … taat ag GATTTC 1.11451 ATGTAG gt aagt … atgc ag ... 1.27117 CATTAT gt aagt … tttc ag GATATT 0.178160 TTGCAG gt ttgt … ttta ag GTTCAA 1.29182 ATGGAC gt atgt … cata ag ATGTCC 3.810 994AAGGAC gt aagt … ttaa ag GATTGC 0.7011176 AGAAGA gt aagt …...

Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx

... areunclear. The ﬁrst reaction of the CDP-ethanolaminebranch of the Kennedy pathway is catalysed by etha-nolamine kinase, resulting in the formation of phosphoethanolamine, which in turn is activated ... [64]. The contribution of the PS decarboxylation reactionand the CDP-ethanolamine branch of the Kennedypathway to PE formation in mammalian cells has beenexperimentally addressed using pathway-speciﬁc ... stableisotope labelling experiments, revealing a preferentialuse of the CDP-ethanolamine pathway over PS decar-boxylation in a ratio of approximately 2 : 1 [65]. Inaddition, the two pathways...

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... M, Kaneko S, Kuno A, Koyama Y, YoshidaS, Park GG, Sakakibara Y, Kusakabe I & KobayashiH (2001) Puriﬁcation and characterization of the recom-binant Thermus sp. strain T2 a- galactosidase ... Transferase action of a- galactosidase from tubers of Stachys afﬁnis. Agric Biol Chem 46, 1089–1090.31 Hashimoto H, Katayama C, Goto M, Okinaga T &Kitahata S (1995) Transglycosylation catalyzed ... trehalose, turanose, rafﬁ-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRhaand pNPaXyl were purchased from Sigma (St. Louis, MO,USA). Galactomannans...

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

... undergopassivization.1Linguists mainly attribute this to the fact that only a referential noun can appear as the surface subject of a passive construction.1There are idiomatic combinations that are ... lexically ﬁxed to the extent thatitsdeviates from the average of its vari-ants. Our measure calculates this deviation, nor-malized using the sample’s standard deviation:(2)is the mean and the ... higher than the threshold are labeled as id-iomatic and the rest as literal.We assess the overall goodness of a measure bylooking at its accuracy (Acc) and the relative re-duction in error rate...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM