Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... Orientale, Alessandria, Italy; 3 Dipartimento di Biochimica e Biologia Molecolare, Universita ` di Parma, Italy This paper reports the isolation and characterization of the regulatory moiety of the ... hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component Ersilia Griva 1 , Enrica Pessione 1 , Sara Divari 1 , Francesc...

Ngày tải lên: 21/02/2014, 00:20

7 515 0
Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

... overall 3900-fold activity compared to the AtSMT cDNA of plant origin. Detailed kinetic analyses of the recombinant protein indicated a random sequential bi-bi mechanism for the SMT-catalyzed transacyla- tion, ... hydrolytic enzymes of primary metabolism [6,8,15]. Although the analyzed SCPL acyltransferases have maintained the nature and configuration of the Ser-His...

Ngày tải lên: 23/03/2014, 07:20

13 310 0
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx

Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx

... assay Oligonucleotides AS1 5¢-AATATACGTTCGATTAA-3¢ and AS2 3¢-TTATATGCAAGCTAATT-5¢ were synthe- sized by Operon on a 50 nm scale. Annealing of each 5¢-oli- gonucleotide with its complementary 3¢-oligonucleotide at ... allows the formation of macro- lactones instead of the native macrothiolactones. Several thiocoraline analogs were isolated and investigated for DNA-bisintercala...

Ngày tải lên: 23/03/2014, 06:20

13 466 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

... are characterized by a conserved array of 20 cysteines and the absence of His and aromatic amino acids. MT3 contains 68 amino acids with 70% sequence identity to the MT1 and MT2 (MT1 ⁄ 2) isoforms. ... is kinetically labile, allowing rapid intra- molecular and intermolecular metal transfer. This is a direct consequence of the relatively high structural dynamics and fl...

Ngày tải lên: 16/02/2014, 15:20

10 569 0
Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

... biomaterials based on layered silica, of titania and of zirconia [32]. This view is based on the finding of a dual role for silicatein as an ana- bolic (silica polymerase) and catabolic enzyme (silica esterase), ... a Finnigan MAT mass spectrometer 8230 (Midland; Canada). In a control assay, the reaction was performed in the absence of silicatein. Esterase activity The...

Ngày tải lên: 18/02/2014, 16:20

9 576 0
Báo cáo khoa học: "Using Conditional Random Fields to Extract Contexts and Answers of Questions from Online Forums" docx

Báo cáo khoa học: "Using Conditional Random Fields to Extract Contexts and Answers of Questions from Online Forums" docx

... skip-chain edges between any pairs of non-contiguous sentences will be computationally expensive, and also introduce noise. To make the cardinality and number of cliques in the graph man- ageable and ... both the union and intersection of the two annotated data. The experimental results on both data are qualitatively comparable. We only re- port results on union data d...

Ngày tải lên: 23/03/2014, 17:20

9 605 0
Báo cáo khoa học: Diện mạo truyện ngắn Hoa Kỳ ba mươi năm đầu thế kỷ 20 potx

Báo cáo khoa học: Diện mạo truyện ngắn Hoa Kỳ ba mươi năm đầu thế kỷ 20 potx

... dfla dng den vdi van hoe va ed nghe dfla dng den canh cifa nha tu- a& apos;y la chan thu quy d ngan hang dia phfldng va la chan chu but sau khi thanh lap td bad hai ra hang tuin la Dd lan vad ... nam trdi qua, anh da cai dflde rfldu va da lai lam an phat dat, anh mud'n cd mot mai a& apos;m gia dinh va Honoria cung mud'n dflde sd'ng cung bd'. Moi chuyen le ra da ....

Ngày tải lên: 15/03/2014, 23:20

12 588 0
Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

... TCC ACC ATG GAT CAC CAT CAC CAT CAC ATG GAG CAC CGA AAG TTA AGA GGT AAC GG 3¢) containing five His codons, a BamH1 site, a Kozak consensus sequence for a proper translation initiation in P. pastoris ... pastoris and also the nine initial bases missing in the isolated cDNA clone. The reverse primer (5¢ AAG GTA GGA ATT CCT AGA ATT TGG AGA TGA AGT C 3¢) contained an EcoR1 site after...

Ngày tải lên: 31/03/2014, 08:20

8 408 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... cannot, however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa- tion properties of the signal at 77 K indicate that the Y Æ is coupled to a paramagnetic ... nrdF + gene was sequenced by a primer walking approach. For DNA analysis, dnastar software (DNAS- TAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & E...

Ngày tải lên: 15/02/2014, 01:20

14 872 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD re...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
w