Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
... plot of AMP–AMP phosphotransferase activity (as
percentage of total activity) in mixtures containing various amounts
of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed
amount of MK ... 0.3
AdK activity in the presence of A1 34974 0
AdK activity in the presence of Ap
5
A 5.46 ± 0.3
Table 3. MK, AdK, ADA and AMP–AMP phosphotransferase activi-
ties in nor...
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,
and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢
and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA
GGGG-3¢ for the latter. The ... lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and Hirotake Ichise
Laboratory of Gene E...
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... automatic
summary can be seen as a particular paraphrasing
task (Barzilay and Lee, 2003) with the aim of se-
lecting the shortest paraphrase.
Paraphrases can also be used to improve natu-
ral language ... sentences as a test
corpus.
4.2 Language model and paraphrase table
Paraphrase generation tools based on SMT meth-
ods need a language model and a paraphrase table.
Both are comput...
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... to each other and to Gambeta.
We amplified the cDNA for cB using forward primer
5¢-ACTTATACTACT
CATATGGGGAAGATCACTTTTT
ACG-3¢ and reverse primer 5¢-ACTTATACTATC
CTCG
AGATAAAAATCCATCACCCG-3¢, and ... Stains-all in
the presence of Gambeta, bB2 and cB crystallin. The
dye Stains-all binding simulates calcium-binding in a
A
B
Fig. 4. Chemical denaturation of Gambeta and its two progenitor...
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantia
nigra pars compacta and appearance of Lewy bodies
consisting of aggregated protein, mainly a- synuclein, in
Keywords
amyloid; fibrillation; Parkinson’s disease;
synuclein; thioflavin T
Correspondence
I. ... H, Okamura K, Bauer PO, Furukawa Y, Shimizu
H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,
Kuroiwa Y et al. (2008) RNA-binding protein TLS is a
major nuclear aggregate-i...
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi
M, Inomata M, Nakamura M, Maruya M & Iwashita S
(2004) Perfringolysin O, a cholesterol-binding cytolysin,
as a probe for lipid rafts. Anaerobe ... 10, 125–134.
19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M,
Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno-
Iwashita Y (2001) Selective binding of perfringolysin O
derivative to cho...
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... each containing a low-potential and a high-potential
[Fe-S]. Thus each structural domain of b may be a transfer
unit for the electron transfer pathway in this enzyme. In our
scheme we have integrated ... time constants
corresponding to apparent rate constants are obtained by
fitting Eqn (1):
DAbs ¼ a þ b e
Àct
ð1Þ
where, DAbs is the variation of absorbance, a and b are
am...
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
...
CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132
*
CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA
AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300
CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA
AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ...
CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...
Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx
... 5. Analysis of N-glycans in the recombinant mAb by lectin blot-
ting. Recombinant mAb was subjected to lectin blotting with AAL
and concanavalin A. The purified recombinant mAb (R) and standard
human ... 1174–1175.
57 Nakakita S, Menon KK, Natsuka S, Ikenaka K &
Hase S (1999) b1-4Galactosyltransferase activity of
mouse brain as revealed by analysis of brain-specific
complex-type N-...
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx
... 0.2
M
GalNAc
GalNAca1 fi 3Gal
Sophora japonica (SJA) Galb1 fi 3GalNAc 0.2
M
Gal
Galb1 fi 3,4GlcNAc
Wistaria floribunda (WFL) a/ bGalNAc 0.2
M
GalNAc
Helix pomatia (HPL) GalNAca1 fi 3GalNAc 0.2
M
GalNAc
GalNAca1 ... within 10 days.
Quantification of alkaline phosphatase and
aminopeptidase activities
Specific alkaline phosphatase (ALP) and N-aminopeptidase
(APN) enzymatic activities of BBMV prote...
Từ khóa: