Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

... plot of AMP–AMP phosphotransferase activity (as percentage of total activity) in mixtures containing various amounts of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed amount of MK ... 0.3 AdK activity in the presence of A1 34974 0 AdK activity in the presence of Ap 5 A 5.46 ± 0.3 Table 3. MK, AdK, ADA and AMP–AMP phosphotransferase activi- ties in nor...

Ngày tải lên: 23/03/2014, 06:20

15 378 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake Ichise Laboratory of Gene E...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

... automatic summary can be seen as a particular paraphrasing task (Barzilay and Lee, 2003) with the aim of se- lecting the shortest paraphrase. Paraphrases can also be used to improve natu- ral language ... sentences as a test corpus. 4.2 Language model and paraphrase table Paraphrase generation tools based on SMT meth- ods need a language model and a paraphrase table. Both are comput...

Ngày tải lên: 17/03/2014, 02:20

4 338 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... to each other and to Gambeta. We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and ... Stains-all in the presence of Gambeta, bB2 and cB crystallin. The dye Stains-all binding simulates calcium-binding in a A B Fig. 4. Chemical denaturation of Gambeta and its two progenitor...

Ngày tải lên: 23/03/2014, 04:21

13 430 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra pars compacta and appearance of Lewy bodies consisting of aggregated protein, mainly a- synuclein, in Keywords amyloid; fibrillation; Parkinson’s disease; synuclein; thioflavin T Correspondence I. ... H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, Machida Y, Miyazaki H, Mitsui K, Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-i...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts. Anaerobe ... 10, 125–134. 19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M, Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno- Iwashita Y (2001) Selective binding of perfringolysin O derivative to cho...

Ngày tải lên: 20/02/2014, 03:20

10 589 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

... each containing a low-potential and a high-potential [Fe-S]. Thus each structural domain of b may be a transfer unit for the electron transfer pathway in this enzyme. In our scheme we have integrated ... time constants corresponding to apparent rate constants are obtained by fitting Eqn (1): DAbs ¼ a þ b e Àct ð1Þ where, DAbs is the variation of absorbance, a and b are am...

Ngày tải lên: 07/03/2014, 15:20

8 443 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

... 5. Analysis of N-glycans in the recombinant mAb by lectin blot- ting. Recombinant mAb was subjected to lectin blotting with AAL and concanavalin A. The purified recombinant mAb (R) and standard human ... 1174–1175. 57 Nakakita S, Menon KK, Natsuka S, Ikenaka K & Hase S (1999) b1-4Galactosyltransferase activity of mouse brain as revealed by analysis of brain-specific complex-type N-...

Ngày tải lên: 23/03/2014, 04:20

15 263 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... 0.2 M GalNAc GalNAca1 fi 3Gal Sophora japonica (SJA) Galb1 fi 3GalNAc 0.2 M Gal Galb1 fi 3,4GlcNAc Wistaria floribunda (WFL) a/ bGalNAc 0.2 M GalNAc Helix pomatia (HPL) GalNAca1 fi 3GalNAc 0.2 M GalNAc GalNAca1 ... within 10 days. Quantification of alkaline phosphatase and aminopeptidase activities Specific alkaline phosphatase (ALP) and N-aminopeptidase (APN) enzymatic activities of BBMV prote...

Ngày tải lên: 23/03/2014, 13:20

9 400 0
Từ khóa:
w