Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

... a bacterial class I c- type cytochrome, Paracoccus denitrif- icans cytochrome c 550 [33]. Moreover, many taxa that have heme lyase apparently have separate heme lyases for the maturation of cytochromes ... 2009 FEBS Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for...

Ngày tải lên: 23/03/2014, 04:21

11 513 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

... bound than the M3 in MtSTP. Crystal contacts at the active site The differential occurrence of the metal ions correlates with the conformation of the flap subdomain (132–174) and the ‘binding’ of adjacent ... agalactiae PPase, kinase and adenylosuccinate syn- thase, but not in S. agalactiae CovR ⁄ CsrR. The motif is located at the surface of the SaPPase (Ranta...

Ngày tải lên: 07/03/2014, 09:20

10 543 0
Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron flavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt

Báo cáo khoa học: Structure of coenzyme F420H2 oxidase (FprA), a di-iron flavoprotein from methanogenic Archaea catalyzing the reduction of O2 to H2O ppt

... to the A- type flavoprotein family (FprA) [22]. One func- tionally and structurally characterized member of this family is the bacterial cytoplasmic NO reductase, which also contains FMN and a nonheme ... in an obligate anaerobic bacteria. Arch Microbiol 181, 324– 330. 22 Wasserfallen A, Ragettli S, Jouanneau Y & Leisinger T (1998) A family of flavoproteins in the doma...

Ngày tải lên: 07/03/2014, 10:20

12 563 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATT CCACCGGT GCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢- GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢),...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

... Stier, Anders O ¨ hman and Michael Murphy for their valuable discussions and critical reading of the manuscript. The work was performed within the Umea ˚ Centre for Microbial Research (UCMR) and was ... A bifurcated hydrogen-bonded conformation in the d (A. T) base pairs of the DNA dodecamer d(CGCAAATTTGCG) and its complex with distamy- cin. Proc Natl Acad Sci US...

Ngày tải lên: 15/03/2014, 23:20

14 459 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... to each other and to Gambeta. We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and ... using for- ward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATC CTCGAGCCACTGCATGTCCCGG-3¢, to produce an amplicon lacking the N- and C- ter...

Ngày tải lên: 23/03/2014, 04:21

13 430 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... of bacteria with their hosts. LPS i s c omposed of lipid A, a c ore oligosaccharide, and an O-polysaccharide (O-antigen) built up of oligosaccharide repeats. The structures of the O-polysaccharides ... [40] and P. tolaasii [41]. In all these bacteria, the inner c ore region has the s ame carbohydrate backbone and may differ only in th e presence and the...

Ngày tải lên: 23/03/2014, 13:20

10 325 0
Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

... tetrasaccharide repeating unit of the polysaccharide consists of two residues of GlcNAc and one residue each of GalNAc, GlcA and AlaLys. The 1 Hand 13 C NMR spectra of the polysaccharide were assigned using ... the O-polysaccharide of Pr. alcalifaciens O23 [23], and an amide of the same amino acid with D -galacturonic acid (structure 2) in the O-polysac-...

Ngày tải lên: 23/03/2014, 21:20

7 346 0
Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

... 5¢-TTCCATACCACCACCT GCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGT GGTGGTATGGAACAGCATGCT-3¢ for primer 3; and 5¢-GGCCACT GGATCCAACTACAGCAATTCTCA-3¢ for primer 4 [the NdeI (primer 1) and BamHI (primer 4) sites are ... to overproduce a His-tagged form of SIB1 FKBP22 [8], was used as a template. The sequences of the PCR primers used are as follows: 5¢-AGAGAGAATT CATATGTCAGAT...

Ngày tải lên: 30/03/2014, 01:20

11 355 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... hydrophobic environments. The spectral change induced by the increased concentration of TFE was nearly complete at about 40–60% TFE/water, and no significant spectral change occurred upon the change of ... in a 50% TFE/water mixture, the CD spectra changed dramatically, with a strong positive band near 192 nm and strong negative bands centered at 208 and 222 nm, which a...

Ngày tải lên: 31/03/2014, 09:20

8 448 0
w