Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... motif of FhaC. The VRGYtetrad is highly conserved in the TpsB family and, in FhaC, it is located at the tip of L6 reaching the periplasm. Replacement by Ala of the invariantArg dramatically affects ... against a major con-formational change of the loop. Structural data are available in the Protein Data Bank under the accession numbers 2QDZ (FhaCWT) and3NJT (FhaCR45 0A ). Importance of conserved ... FhaCR45 0A , clearlyindicating the presence of many conductance substatesand impairing the determination of a precise value of conductance (Fig. 5C, part c). At negative potentials, the channels...
- 11
- 396
- 0
Báo cáo khoa học: Functional genomics by NMR spectroscopy Phenylacetate catabolism in Escherichia coli docx
... Consequently, the PaaF and PaaH proteins appear tocatalyse reactions in the downstream part of phenylacetatedegradation. In the absence of the PaaF and PaaH proteins,catabolism of phenylacetate is ... suggests a role for the PaaG and PaaZproteins early in the pathway. The other major finding isthat C6dicarboxylic acids formed later in the pathway arederived from the aromatic ring carbons of ... and acetyl-CoA appears to be catalyzed by the PaaJ, PaaF and PaaH proteins.Keywords: aromatic metabolism; phenylacetate; phenyl-acetyl-CoA oxygenase; phenylalanine metabolism. The aerobic catabolism...
- 8
- 310
- 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot
... SchwartzbergNational Human Genome Research Institute, National Institutes of Health, Bethesda, MD, USAIntroductionAmong the key players in intracellular signaling in lym-phocytes are the Tec family kinases ... cascade of signal-ing events initiated by the activation of the Src-familykinase Lck, which phosphorylates immunoreceptortyrosine activation motifs on the intracellular domains of CD3, leading ... signaling, requiredfor full activation of phospholipase Cc, and downstream Ca2+and ERK-mediated signaling pathways. Over the last 10 years, data have implicated the Tec family kinases Itk and...
- 10
- 312
- 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... DiscussionSulfonimides as inhibitors of RNase A We began by determining the ability of three backboneanalogs of RNA to inhibit catalysis by RNase A. These analogs have a simple polyanionic backbonewith neither a ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A ... further development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the...
- 9
- 626
- 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed to introduce ... coordi-nated by an oxygen donor group derived from the carboxylate side chain of either a glutamate or anaspartate. The apparent conflict of this finding with the absence of a coordinating carboxylate ... in a total volume of 600 lL,which contained 10 lL of enzyme, appropriately diluted tomeasure the initial rate. The enzymatic rate was obtainedfrom the linear plot of substrate converted against...
- 15
- 624
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... staphy-lococcal adhesins, comprising an N-terminal region that binds fibrinogenand elastin, and a C-terminal domain that interacts with fibronectin. The C-terminal domain of fibronectin-binding ... FEBSMonoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the recombinant FnBR indicated the generation ... Den-mark) for 45 min. The binding of the secondary antibodywas quantified by adding the substrate o-phenylenediaminedihydrochloride and measuring the resulting absorbanceat 490 nm in a microplate...
- 16
- 560
- 0
Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt
... areparasitic protozoa belonging to the order Kinetoplast-ida. They are causative agents of several highly disab-ling and often fatal diseases, including African sleepingsickness, Chagas disease ... exhibits another variation in the first steps of the pathway. C18 FAs are elongated to C20, andthen a D8 desaturase produces the same kind of C20FAs that will be the substrate of D5 desaturase.Although ... b5 as an N-terminaldomain and three histidine boxes in the desaturase(C-terminal) domain. The third histidine box has the QX2HH instead of the HX2HH motif present in othertypes of desaturases...
- 10
- 476
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); ... coding sequence, using primers (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), and checked for the ... stimulation of the receptor by its ligands activates a MAP kinase signaling pathwayand induces luciferase synthesis. The sensitivity of the bioassay was signifi-cantly enhanced using mammalian...
- 14
- 473
- 0
Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx
... isolatedfrom strains retaining CrtO, this carotene appears tobe in the all-trans form. A characteristic difference in the carotenoid content of the PS1-less mutant and the derived strain lackingechinenone ... Koyama Y, Takii T, Saiki K & Tsukida K (1983) Con-figuration of the carotenoid in the reaction center of photosynthetic bacteria. 2. Comparison of the Reso-nance Raman lines of the reaction ... by X-ray structural analysis of a prokaryotic [5] and an eukaryotic [17] cyt b6f complex:both in the case of the cyanobacterial complex (Masti-gocladus laminosus) and the green algal complex(Chlamydomonas...
- 11
- 520
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... beenpartially induced against the linear isoform of the HNEpeptide. Although the binding pattern may be somewhatblurred by these antibodies and by the polyclonal nature of the sera, the importance ... [32].Evenasmallsidechaininposition388wouldresultinsterichindrance with the main-chain nitrogen atom of K389,damaging the shape of the loop. The above spatialarrangement explains that the HNE epitope does not form a continuous stretch of ... interaction in the peptide, a small, uncharged amino acid such as Ala may reduce sterichindrance. In this context, it is interesting that the introduction of a negative charge in position 392 alsoimproves...
- 13
- 492
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM