Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... Computational Linguistics All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision Mitesh M. Khapra Anup Kulkarni Saurabh Sohoney Pushpak Bhattacharyya Indian ... source domain and Health as the tar- get (test) domain. 4. Health to Tourism (H→T) where Health is used as the source domain and Tourism as the target (test) domain...
Ngày tải lên: 17/03/2014, 00:20
Tài liệu Báo cáo khoa học: "Bilingually Motivated Domain-Adapted Word Segmentation for Statistical Machine Translation" pptx
... translation task at hand by taking the corresponding source (target) language into account. Secondly, this approach does not rely on manu- ally segmented training data so that it can be automatically ... automatically adapted for differ- ent domains. We evaluate the perfor- mance of our segmentation approach on PB-SMT tasks from two domains and demonstrate that our approach scores con- si...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... for mutagenesis. Primer Sequence (5¢-to3¢) Vps4–DEL F TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT Vps4–DEL R ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4–TRP ... R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG Vps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table 2. Yeast strains used in this study. Strain Genoty...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx
... rat brain. Biochim Biophys Acta 1323, 1–5. 7 Terashita A, Funatsu N, Umeda M, Shimada Y, Ohno- Iwashita Y, Epand RM & Maekawa S (2002) Lipid binding activity of a neuron-specific protein NAP-22 ... by a myristoylated NAP-22 peptide and its Tyr mutant Raquel F. Epand 1 , Brian G. Sayer 2 and Richard M. Epand 1,2 1 Department of Biochemistry and Biomedical Sciences, McMaster Unive...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc
... obtained for b-apo-8¢-carotenal, followed by 3-OH-b-apo-8¢- carotenal and b-apo-10¢-carotenal and, finally, by 3-OH-b-apo-10¢-carotenal. However, b-apo-8¢-carotenal showed a lower k cat value compared to ... Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu K, Yoneyama K et al. (2008) Inhibition of shoot branching by new terpenoid plant horm...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: The impact of G-protein-coupled receptor hetero-oligomerization on function and pharmacology pptx
... coupling and on receptor internalization, b-arres- tin also plays a major role in GPCR activation of mitogen-activated protein kinase (MAPK). In this con- text it may act as an adaptor or scaffolding ... plasma membrane and to stimulate ERK1 ⁄ 2 phosphorylation. All these data indicate quite clearly that homo-oligomerization and hetero-oligomerization have a pivotal role in defining...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... primor- dial germ-cell development and germ-cell malignancy. Nature 460, 909–913. 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced ... demonstrating that placenta can yield higher amounts of HSCs than umbilical cord blood, and further suggesting that placenta could be banked and used for clinical transplant in a...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... of a multi- domain nonribosomal peptide synthetase. Abbreviations A domain, adenylation domain; ANL, aryl and acyl CoA synthetases, NRPS A domains and firefly luciferases; A- PCP(D-4Cys), the gramicidin ... S synthetase I A domain and the PCP domain (C60F, C33 1A, C376S, C47 3A) ; A- PCP, the gramicidin S synthetase I A domain and the PCP domain; ApCpp, adenosine-...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... of mammalian trans- glutaminases, particularly as regards their protein substrates and the relevance of transglutaminase-catalysed reactions in physiological and dis- ease conditions. Abbreviations CE, ... Pucci P, Amoresano A, Marino G, Cozzo- lino A & Porta R (1996) Transglutaminase from rat coagulating gland secretion. Post-translational modifi- cations and activation by phosph...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "Combining Multiple, Large-Scale Resources in a Reusable Lexicon for Natural Language Generation" pptx
... the same class have the same syntactic behav- ior in terms of allowable alternations. EVCA specifies a mapping between words and word classes, associating each class with alternations and ... semantic para- phrases in PlanDOC domain. At the lexical level, we use synonymous words from WordNet to generate lexical paraphrases. A sample lexi- cal paraphrase for "The bas...
Ngày tải lên: 31/03/2014, 04:20