Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da. The total calculated average molecular mass ... a functional Mo catalytic center. The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic reduction of the enzyme with 1 m...
Ngày tải lên: 16/03/2014, 23:20
... of immunoreactivity in the latter strain was due to the inability of the truncated protein to insert into and be stable in the inner mitochondrial membrane or lack of detection of the truncated protein ... c 1 and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 significantly decreased in...
Ngày tải lên: 19/02/2014, 12:20
... time-dependent increase of the mRNA abun- dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and P4ha2, starting around 4 h of hypoxia, the induction of P4ha2 mRNA being stronger than that of P4ha1 (Fig. ... as the relative mRNA/b-actin mRNA ratio. The mRNA/b-actin mRNA ratio of the time standards (pools) cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data are ther...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... execute commands. The main functions of ATLAS are the following : - Editing and updating of indexing charts : compi- lation of an external form of the chart, and modification of the internal form ... may be represented by associating questions to each node and the possible answers to the arcs coming from a node ; the leaves of the tree bear the name of...
Ngày tải lên: 17/03/2014, 19:21
Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx
... were used as primary antisera (Table 3). Secondary antibodies (anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; all raised in goat and conjugated to alkaline-phosphatase; Sigma, Saint Louis, ... France Introduction Modification of the chirality of a single aminoacyl resi- due within a peptide chain is a subtle and intriguing mechanism that remains poorly known to date, and...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) Prasanth Potluri, Nagendra Yadava and Immo ... subunits of the integral membrane- subcomplex also assemble via the formation of distinct and i dentifiable assembly intermediates. The mutants promise to be valuable tools in t...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf
... adaptations in the eye in the human lineage. In addition to the evolution of cN and cS crystal- lins, even more specialization in the c-crystallins has occurred with the loss of the N-terminal ... use of animals complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Intramural Animal Care and Use program of the...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... GateCPUfor (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate- HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg). The ... forward: CPU-for1 (tgctctagagcg gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1- rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cgggg...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot
... and arabinogalactan [6,7]. ABNs attack the glycosidic bonds of the a- 1,5-l-arabinan backbone, releasing a mixture of arabinooligosaccharides and l- arabinose [4]. These types of enzyme have attracted much ... and de-branched arabinans, and heteropolysaccharides such as arabinoxylans and arabinogalactans. Arabinan is composed of a- 1,5-linked l-arabinofuranosyl units, some of...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In order to overexpress 4-1BB and TRAF1 in the HeLaTR cells, t...
Ngày tải lên: 23/03/2014, 18:20