0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated averagemolecular mass of 87 392 Da. The total calculated averagemolecular mass ... a functional Mo catalytic center. The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic reduction of the enzyme with 1 mM xanthine relative to the absorptionchange ... functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase Nikolai V. Ivanov1, Frantisek Huba´lek2, Manuela Trani1and Dale E. Edmondson1,2Departments of 1Chemistry...
  • 11
  • 584
  • 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... of immunoreactivity in the latter strain was due to the inability of the truncated protein to insert into and be stable in the inner mitochondrial membrane or lack of detection of the truncated protein ... c1and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 significantly decreased in this mutantstrain. However, the amounts of ... protein 1 and coreprotein 2 were relatively unaffected. Therefore, the absence of subunit 6 appeared to alter the rates of processing of two of the redox subunits and caused minor changes in amountsof...
  • 10
  • 517
  • 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... time-dependent increase of the mRNA abun-dance in A7 r5 cells incubated at 1% oxygen for P4ha1 andP4ha2, starting around 4 h of hypoxia, the induction of P4ha2 mRNA being stronger than that of P4ha1 (Fig. ... as the relative mRNA/b-actin mRNA ratio. The mRNA/b-actin mRNA ratio of the time standards (pools)cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Dataare therefore expressed as relative values ... corroborated by the findings that the stimulatory effect of hypoxia on geneexpression was absent in cells with a functional inactive HIFor lacking the HIF- 1a protein in general. In fact, for the P4ha1I...
  • 8
  • 434
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx

... execute commands. The main functions of ATLAS are the following : - Editing and updating of indexing charts : compi- lation of an external form of the chart, and modification of the internal form ... may be represented by associating questions to each node and the possible answers to the arcs coming from a node ; the leaves of the tree bear the name of the code and an example. A language ... Translation (CAT) application. Previously, linguists used indexing manuals when adding new words to dictionaries. These manuals contained indexing charts, sorts of graphs enabling the search...
  • 4
  • 404
  • 0
Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

... wereused as primary antisera (Table 3). Secondary antibodies(anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; allraised in goat and conjugated to alkaline-phosphatase;Sigma, Saint Louis, ... FranceIntroductionModification of the chirality of a single aminoacyl resi-due within a peptide chain is a subtle and intriguingmechanism that remains poorly known to date, andwhich leads to structural and functional ... dispersed in the X organ (Fig. 3A) , most likely as a result of arte-factual displacement of the cell bodies during the prep-aration of the organ. In the sinus gland, different types of axonal arborizations...
  • 13
  • 687
  • 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... The role of the ESSS protein in the assembly of a functional and stablemammalian mitochondrial complex I (NADH-ubiquinoneoxidoreductase)Prasanth Potluri, Nagendra Yadava and Immo ... subunits of the integral membrane-subcomplex also assemble via the formation of distinctand i dentifiable assembly intermediates. The mutants promise to be valuable tools in the elucidation of the assembly ... differ-ences in the N-terminal domain (located on the matrix side).It is likely that the N-terminal domain is involved in protein–protein interactions with other hydrophilic domains of neighboring integral...
  • 9
  • 622
  • 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... adaptations in the eye in the human lineage. In addition to the evolution of cN and cS crystal-lins, even more specialization in the c-crystallins hasoccurred with the loss of the N-terminal ... use of animals complied with the ARVO Statementfor the Use of Animals in Ophthalmic and Vision Researchand the Intramural Animal Care and Use program of the National Institutes of Health (NIH).G. ... the ‘missing link’ between the b and c crystallin lineages. Overall, there are four major classes of c-crystallin: the terrestrial group (including mammalian cA–F); the aquaticgroup (the fish...
  • 16
  • 561
  • 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc

Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc

... GateCPUfor(ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgcagtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate-HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgatgatgatgatgatgatgatg). The ... forward: CPU-for1 (tgctctagagcggccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga catgccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatgatgatgatgatgatgatgct ... plates. The stability of activity of the re-grown clones was deter-mined again by incubating the activated CPU at 37 °C andusing the same protocol as used in the primary screeningdescribed above.Determination...
  • 15
  • 397
  • 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

... and arabinogalactan [6,7]. ABNs attack the glycosidic bonds of the a- 1,5-l-arabinan backbone,releasing a mixture of arabinooligosaccharides and l-arabinose [4]. These types of enzyme have attractedmuch ... andde-branched arabinans, and heteropolysaccharidessuch as arabinoxylans and arabinogalactans. Arabinanis composed of a- 1,5-linked l-arabinofuranosyl units,some of which are substituted with a- 1,3- ... 2010)doi:10.1111/j.1742-4658.2010.07870.xEndo-1,5 -a- l-arabinanases are glycosyl hydrolases that are able to cleave the glycosidic bonds of a- 1,5-l-arabinan, releasing arabino-oligosaccharidesand l-arabinose. Two extracellular endo-1,5 -a- l-arabinanases...
  • 13
  • 568
  • 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

... designated HeLaTR/4-1BB and HeaLaTR/TRAF1, respectively. Primers for amplifying the 4-1BB andTRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGAAACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAGCTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGGAACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGGGTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In order to overexpress 4-1BB and TRAF1 in the HeLaTRcells, the entire coding ... promoter and examined the caspase activities.Although HeLaTR/TRAF1 expressed significant amounts of TRAF1 mRNA (Fig. 5C), the caspase activity in the HeLaTR/TRAF1 cells was almost the same as that in...
  • 10
  • 491
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ