Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
... also assayed LysoSensor green staining of a vma1D strain, which lacks the 118-kDa subunit of the V-ATPase (Fig. 5A) and is defective in vacuolar acidification. Compared to the ers1D strain (data ... is a lysosomal storage disease caused by an accumulation of insoluble cystine in the lumen of the lysosome. CTNS encodes the lyso- somal cystine transporter, mutati...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... subunits are able to modulate almost all aspects of the channel properties, including voltage dependent gating, activation and inactivation, as well as greatly increasing the number of functional channels present ... in the presence of antisense primer SB1-20 (5¢-TC AAACCACACCCCGAGAAA-3¢)and[ 32 P]dATP[aP] (3000 CiÆmmol )1 ; Amersham Pharmacia Biotech.), follow- ing the manufa...
Ngày tải lên: 16/03/2014, 23:20
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... for the catalytic modules of other polymerases [11]. Furthermore, the conservation of catalytic aspartate residues and their 3D arrangement suggest that the catalysis mode is probably comparable with ... best of our knowledge, Rep245 typifies the shortest functional domain from a crenarchaeal plasmid endowed with DNA and RNA synthesis and terminal transferase activity. Abbrev...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD 5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggct atcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) or basal (b) layer of the VNE. Scale bars indicate 1 mm and 100 lm for the l...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... rate Me ´ lanie Hall, Prabuddha Bansal, Jay H. Lee, Matthew J. Realff and Andreas S. Bommarius School of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, GA, USA Introduction The ... from various samples may provide valuable information about the details of the mecha- nistic action of cellulase and the hydrolysable ⁄ reactive fractions of cell...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
... demonstrated the safety and efficacy of adeno-associated virus (AAV)-mediated calpain 3 cDNA transfer in a mouse model of LGMD 2A [26]. However, gene therapy still has some obstacles that remain to ... Sorimachi H, Toyama-Sorimachi N, Saido TC, Kawasaki H, Sugita H, Miyasaka M, Arahata K, Ishiura S & Suzuki K (1993) Muscle-specific calpain, p94, is degraded by autolysis immediately...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... bp fragment was obtained after the annealing of the two following synthetic oligonucleotides For EGT 5¢- GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back ... 00 Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thr c 0 1.4 NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thr c NeuAca2-6(3)Galb1-4GlcNAc-R c Asialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83 Galb1-4GlcNAc-R...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 38 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K & Shen J-R (1995) Isolation and characteri...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx
... gagt … tcac ag GGATAT 1.8 3 105 CAACAG gt aata … ttcc ag ACGTAT 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT ... 1024 AAGGAC gt aagt … ttca ag GATTGC 0.57 11 176 AGAAGA gt aagt … ttgc ag CAATTT 4.5 12 130 ATGTTG gt gagt … tttt ag GGCATA 3.9 13 85 ACTCAA gt aagg … taat ag GATTTC 1.1 14 51 ATGTAG gt aagt …...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... bp, respectively. A single AATAAA polyadenylation signal was found 11 nt upstream of the poly (A) tail. There was only one stop codon (TAA) at the 3¢ terminus of the ORF. The cDNA sequence has been submitted ... toxin, also contained a Tyr residue at this position. AaHIT 4 ,the unique anti-insect toxin also has a toxic effect on mammals and can acts on the a- andb-sites...
Ngày tải lên: 31/03/2014, 09:20