Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... by T-cell-line-adapted HIV-1. Nature 382, 833–835. 7 Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, Virelizier JL & Arenzana-Seis- dedos F (1999) Stromal- derived factor is ... stromal cell-derived factor (SDF) -1alpha. Glycobiology 10, 21– 29. 34 Valenzuela-Fernandez A, Palanche T, Amara A, Mage- rus A, Altmeyer R, Delaunay T, Virelizier JL, Baleu...
Ngày tải lên : 16/03/2014, 18:20
  • 15
  • 423
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... 25 2.2 2 1.8 1.4 1.2 1.6 1 0.8 0.6 0.4 0.2 0 A 600 A 600 A 600 Time (h) Fig. 5. His41 is essential for Paracoc- cus pantotrophus NirF, but Asp129 is dis- pensable. Growth plots and time courses of nitrite appearance and disappearance for P. ... 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) Gene cluster for dissimilatory nitrite reductase (nir) from Pseudomon...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of the vacuolar ... peroxisomal aspartate aminotransfer- ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45 kDa (Fig. 1A) [15]. The predicted molecular mass of Lpx1p is 44 kDa. It carries a...
Ngày tải lên : 07/03/2014, 05:20
  • 11
  • 568
  • 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

... sulfoxide were added to each well and gently shaken for 10 min. The absorbance was determined at 492 nm with plate reader (Sunrise, Tecan, Gr ¨ odig, Austria). Data analysis Data were analyzed by ... reaction volume with rTaq DNA polymerase or LA Taq TM DNA polymerase with GC buffer (TaKaRa). Human NANOGP8 mRNA was amplified by RT-PCR using total RNAs extracted from urinary bladder cancer ti...
Ngày tải lên : 07/03/2014, 12:20
  • 8
  • 495
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... http://mips.gsf.de/proj/ yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, ... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATT...
Ngày tải lên : 07/03/2014, 15:20
  • 8
  • 485
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... probe and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All ... genes and connective tissue pattern- ing. Development 121, 693–705. 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo...
Ngày tải lên : 07/03/2014, 17:20
  • 16
  • 476
  • 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... site-specific mutagenesis – distal effects on dimer stability Moumita Samanta 1 , Mousumi Banerjee 1 , Mathur R. N. Murthy 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysic...
Ngày tải lên : 14/03/2014, 23:20
  • 12
  • 393
  • 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12]. Consistent with this ... proteins and interacts with skeletal a- actin in the cytoplasm. However, little is known about the mechanism whereby hhLIM interacts with skeletal a- actin and regulates the organization and rea...
Ngày tải lên : 16/03/2014, 06:20
  • 11
  • 347
  • 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

... amylin to evaluate its effect on amylin aggregation. Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scat- tering assays and HPLC analysis at selected ... aggregation may begin to appear. This promotional effect will then lead to enhanced amyloid formation and make amyloid degradation more difficult. We showed that this promotional effect was sig...
Ngày tải lên : 23/03/2014, 04:21
  • 7
  • 388
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masar...
Ngày tải lên : 18/02/2014, 17:20
  • 11
  • 873
  • 0

Xem thêm