Báo cáo khoa học: Binding of non-natural 3¢-nucleotides to r

Báo cáo khoa học: Binding of activated Factor XII to endothelial cells affects its inactivation by the C1-esterase inhibitor pptx

... Initiation of activation of the system has been found to be a result of a slow autodigestion and autoactivation of surface bound FXII by FXIIa [2]. Binding of FXII to a negatively charged surface induces ... doi:10.1046/j.1432-1033.2003.03367.x accompany inﬂammation and tissue damage which is thought to play a major role in the symptomatology of acute attacks in pa...

Ngày tải lên : 23/03/2014, 20:22

8
429
0

Báo cáo khoa học: "Applications of Automatic Evaluation Methods to Measuring a Capability of Speech Translation System" pot

... Applications of Automatic Evaluation Methods to Measuring a Capability of Speech Translation System Keiji Yasuda ATR Spoken Language Translation Research Laboratories 2-2-2, Hikaridai,"Keihanna ... City", Kyoto, 619-0288, Japan Seiichi Yamamoto  Masuzo Yanagida ATR Spoken Language  Doshisha University Translation Research Laboratories  1 - 3, Tatara-miyakodani, Kyotanabe...

Ngày tải lên : 31/03/2014, 20:20

8
274
0

Báo cáo khoa học: Binding of non-natural 3¢-nucleotides to ribonuclease A ppt

... interaction of RNase A and 3¢-nucleotides, and indicate that non-natural fura- nose rings can serve as the basis for more potent inhibitors of catalysis by RNase A. Abbreviations araUMP, arabinouridine ... was added, and subsequent additions again doubled in volume until a 32-lL aliquot had been added, for a total of nine additions (75.5 lL) altogether. In each assay, 15%...

Ngày tải lên : 16/03/2014, 18:20

12
576
0

Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP speciﬁc phosphodiesterase (PDE5a1) potx

... SDS/PAGE. Caspase-3 activity assays Caspase-3 activity in cell lysates was measured using [ 35 S]methionine-labeled PARP as a substrate. In each assay, equal amounts of cell lysate protein ( 5 lg/assay) were ... cleavage of intermediate fragments, as a result of particularly good overexpression of the enzyme in Cos-7 cells. Cotransfection of PDE 5A1 did not affect the auto-acti...

Ngày tải lên : 17/03/2014, 09:20

9
391
0

Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc

... densitometry. The percentages of each band regarding to the total signal of PrP C were calculated as arithmetic means of separate gel runs. The number of gel runs for the analyses are given for each ... Gomez Parada M & Groschup MH (2000) Molecular analysis of Irish sheep scrapie cases. J General Virol 81, 1621–1627. 36 Hayashi HK, Yokoyama T, Takata M, Iwamaru Y, Imamura M, U...

Ngày tải lên : 19/02/2014, 02:20

11
536
0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Aiba Y, Nakamura K, Namba T, Hirata M, Mazda O, Katsura Y & Narumiya S (1993) Thromboxane A2 receptor is highly expressed in mouse immature thymocytes and mediates DNA fragmentation and apoptosis. ... pGL3e:Prm3aab. (Primer Kin160; 5¢-dGAGA GGTACCGCAAATCTTCTCTCGCC TCC-3¢, corresponding to NTs )106 to )86). (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa. (Primer Kin161, 5¢-dGAGA GGTAC...

Ngày tải lên : 19/02/2014, 16:20

18
509
0

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... anthraquinone- 2-sulfonate, safranine O, diquat, neutral red, phenosafranine, and methylviologen, all at a ratio of 100 : 8 of cytochrome vs. mediator to avoid interference caused by speciﬁc binding of mediators to ... Delgado R, Frausto da Silva JJR, Amorim MTS, Cabral MF, Chaves S & Costa J (1991) Dissociation constants of Bronsted acids in D 2 O and H 2 O: studies on po...

Ngày tải lên : 19/02/2014, 17:20

10
640
0

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... can also arise via radical Table 2. Percentage of enzyme activity retained after incubation of GAPDH, GR and LDH with N-Ac-Trp-OMe peroxides or H 2 O 2 at 37 °Cinthe absence, or presence, of a ... (¤) Catalase added; (h) no catalase added. Initial peroxide concentrations were in the range of 420–520 l M for RNase A, 540–660 l M for N-Ac-Trp-OMe, and 130–180 l M for lysozyme. Data a...

Ngày tải lên : 21/02/2014, 03:20

10
462
0

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

... be related to partial catalytic activation following (Mg)ATP binding at physiological concentrations of Glc. Similar or possibly larger effects of ATP in promot- ing a catalytically competent state ... glucokinase cause hypoglyca- emia- and hyperglycaemia syndromes and their analysis illuminates fundamental quantitative concepts of glu- cose homeostasis. Diabetologia 42, 1175–1186...

Ngày tải lên : 06/03/2014, 00:20

15
374
0

Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt

... S, Komori N, Matsumoto H, Matsuura I, Hayashi F, Yamazaki RK & Usukura J (2010) Mechanism for the regulation of mammalian cGMP phosphodiesterase 6. 2: isolation and characterization of the transducin- activated ... cGMP to Pabc is not involved PDE activation Binding of [ 3 H]cGMP to Pabc implies that cGMP binding may be involved in the activation of P abcc to Pabc and ⁄...

Ngày tải lên : 06/03/2014, 00:21

19
406
1