Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... Identification of amino acids in antiplasmin involved in its noncovalent ‘lysine-binding-site’-dependent interaction with plasmin Haiyao Wang, Anna Yu, Bjo¨ rn Wiman and Sarolta Pap Department of Clinical ... suggests that the lysine-binding-site-dependent interaction between antiplasmin and plasmin occurs in the C-terminal part of antiplasmin. It is also known that antipla...

Ngày tải lên: 17/03/2014, 03:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAG...

Ngày tải lên: 16/03/2014, 16:20

... architecture of IB proteins [14,15] has led to the use of these underesti- mated bacterial aggregates as intriguing models for the analysis of protein protein interactions in the context of amyloid and ... non-natural amino acids. This observation, which indicated the transient nature of protein aggregates formed by conformation- ally aberrant proteins, was more r...

Ngày tải lên: 06/03/2014, 00:20

... PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were designed to introduce ... histidine- containing motifs separated by a variable intermotif region provide the signature for the superfamily and contribute the residues for metal binding [1,2]. A wide range...

Ngày tải lên: 18/02/2014, 06:20

... sites. In the case of the titin and twitchin kinases, the autoinhibitory sequence acts as a pseudo- substrate, occluding ATP binding and preventing protein substrates from binding (reviewed in [9]). PhK ... An intrinsic calmodulin (CaM, the d subunit) binds directly to the c protein kinase chain. The interaction site of CaM on c has been localized to a C-terminal...

Ngày tải lên: 19/02/2014, 17:20

... Biological, translational, and clinical language pro- cessing, Prague, CZ. David Ferrucci and Adam Lally. 2004. UIMA: An Ar- chitectural Approach to Unstructured Information Processing in the Corporate ... substantial recall gains on the minority classes. 1 Introduction Since the beginning of the new millennium, there has been a growing need in the medical community...

Ngày tải lên: 20/02/2014, 05:20

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP 1 2 3 1 1 2 3 { } 324 X ...  X a X d X b X a X b X d ≺ X a ≺ X b ≺ X c ≺ X d ≺ X e X d ≺ X a ≺ X b ≺ X c ≺ X e X d     ≺  ≺   ≺  ≺    d(Y  , Y  ) 326      ❄ ❳ ❳ ❳ ❳ ❳③ ✘ ✘ ✘ ✘ ✘✾ ❄❄ ❄ ❄ X...

Ngày tải lên: 20/02/2014, 07:20

... extracts (data not shown). The intensity of the Mcm4 band was clearly decreased at 22 h chase in both HeLa and WI-38 cells, indicating the presence of turnover of the protein. Quantitation of the ... over-replication in Saccharomyces cerevisiae [20]. These findings indicate that Mcm proteins play a role in regulating the replication of DNA. The gene amplificati...

Ngày tải lên: 20/02/2014, 23:20

... described in the following were obtained fully automatically. That means that errors in the shallow feature generation meth- ods could propagate into the model that was learned from the data. The advantage ... identified and corrected. The annotators then individually per- formed the actual annotation again. The results reported in the following are from this second a...

Ngày tải lên: 22/02/2014, 02:20

... used for the treatment of graft-versus-host disease and suppresses atopic dermatitis in animal models [6,25]. Efalizumab is a humanized IgG1 mAb that also targets the CD1 1a chain of LFA-1 and ... LFA-1 from interacting with ICAM-1. E falizumab has b een successfully used in phase III clinical trials in patients with psoriasis [26]. Natal- izumab (tysabri), a mAb to the...

Ngày tải lên: 07/03/2014, 12:20