Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... 2004 Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme Alan Y L. Lee 1,2 , San-San Tsay 3 , ... Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi, K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of the LonproteasegenefromThermus therm...
Ngày tải lên: 16/03/2014, 16:20
... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forward d(AAA GGT GGC AAA GGT GGA GAC AGA GGT GGC TT) and KGG3-2 reverse d(GAA CAT TCC ACC GGG ACC ACC AC). pGEX–KGG3-4 was generated by PCR using pGEX–KGG2 as a tem...
Ngày tải lên: 15/02/2014, 01:20
... AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) This study Kan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19] Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Barenkamp SJ, Robbins JB, Tsai CM, Lim DJ & Battey J (1998) Synthesis and characteriza- tion of lipooligosaccharide-based conjugates as vaccine candidates for Moraxella (Branhamella) c...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723 RpCAbrR3 ... 706–723 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFp...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... structure–function relationship analysis of Prismalin–14 from the prismatic layer of the Japanese pearl oyster, Pinctada fucata. FEBS J 274, 5158–5166. 9 Murayama E, Takagi Y, Ohira T, Davis JG, Greene MI & Nagasawa H ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organism...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose ... DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢. One strand...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... Sweden; 3 Swansea Clinical School, University of Wales Swansea, UK; 4 School of Life and Health Sciences, Aston University, Birmingham, UK Aquaporins and aquaglyceroporins mediate the transport of waterandsolutesacrossbiologicalmembranes.Saccharo- myces ... discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembrane transport [1]....
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene Peter Barath 1,2 , Daniela Poliakova 1,2 , Katarina Luciakova 1,2 and B. Dean Nelson 1 1 Department ... Institute, Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava, Slovak Republic. Fax: + 421 259327250, Tel.: + 421 259327110, E-mail: Katarina.Luciakova@savba.sk Abbreviations: A...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... (425/93 and NM115) or fermenter-grown (1000 and its galE mutant) strains by standard methods. Sugar analysis of the LPS-derived alditol acetates from the parent strains revealed glucitol, galactitol, ... glycoforms were also observed for strains 425/93 and 1000 (Table 1). Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined by MS. A range of...
Ngày tải lên: 08/03/2014, 02:20