0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... 2004 Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme Alan Y L. Lee1,2, San-San Tsay3, ... Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi,K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of theLonproteasegenefromThermus thermophilus HB8 and char-acterization of its ... sequence comparison analyses of Bt -Lon and B. subtilis Lon protease (Bs -Lon) .Materials and methodsBacterial identification and culture conditionsAll biochemical tests and identification procedures...
  • 11
  • 505
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forwardd(AAA GGT GGC AAA GGT GGA GAC AGA GGTGGC TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers: ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect ... S, Gibson BW & Campagnari AA(2005) Characterization of a cluster of three glycosyl-transferase enzymes essential for Moraxella catarrhalislipooligosaccharide assembly. J Bacteriol 187,...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe amplification for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... sequenced RpCAtr (BPNJ¼ 100 and BPMP¼ 99). Fungia scutaria (FCA -a and FCA-b) and Caenorhabditis elegans (CA1 and CA2) sequences falloutside of clade I and are more closely related to eachother...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... structure–functionrelationship analysis of Prismalin–14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa H ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis...
  • 12
  • 568
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA ... CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA GTACTTGCGCTCAGGAGGAG 312Role of CA9 in PYM resistance G. Zheng et al.4516...
  • 13
  • 563
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... bp wasproduced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAACAAACACAC-3¢, reverse primer: 5¢-AAGATGGTATTGAAGATGATGGTTGA-3¢), purified from agarose ... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGTCATGACCTCG-3¢. One strand of each oligonucleotide ... Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with32P using a Metaprime kit (Amer-sham Pharmacia Biotech Inc., Piscataway, NJ, USA). ForBAC DNA sequencing, the BAC clone was...
  • 16
  • 542
  • 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... Sweden;3Swansea Clinical School, University of Wales Swansea, UK;4School of Life and Health Sciences, Aston University, Birmingham, UKAquaporins and aquaglyceroporins mediate the transport of waterandsolutesacrossbiologicalmembranes.Saccharo-myces ... discovery of the aquaporins marked a breakthroughin our understanding of water and solute transmembranetransport [1]. Aquaporins and aquaglyceroporins [the majorintrinsic protein (MIP) family] have ... in archea,eubacteria, fungi, plants, animals and human [2,3]. Aqua-porins facilitate the diffusion of water across biologicalmembranes while the closely related aquaglyceroporinsmediate transport...
  • 9
  • 383
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... Identification of NF1 as a silencer protein of the human adeninenucleotide translocase-2 gene Peter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2 and B. Dean Nelson11Department ... Institute, SlovakAcademy of Sciences, Vlarska 7, 833 91 Bratislava, Slovak Republic.Fax: + 421 259327250, Tel.: + 421 259327110,E-mail: Katarina.Luciakova@savba.skAbbreviations: ANT, adenine nucleotide ... wereseparated on 4% nondenaturing polyacrylamide gel. Thegels were dried and autoradiographed. Competitor DNAsused in EMSA analysis were: NF1 wt, 5¢-TTTTGGATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTTGGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGTCTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTTTGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAATGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt,5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut,5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢.Chromatin...
  • 8
  • 426
  • 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... (425/93 and NM115)or fermenter-grown (1000 and its galE mutant) strains bystandard methods. Sugar analysis of the LPS-derivedalditol acetates from the parent strains revealed glucitol,galactitol, ... glycoformswere also observed for strains 425/93 and 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined by MS. A range of molecular masses was found ... observed are dueto the presence of an additional phosphate group (1032), and additional PEtn moiety (1075), an additional phosphate group and an additional PEtn moiety (1155) and one additional phosphate...
  • 8
  • 361
  • 1

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM