Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... Authors Journal compilation ª 2006 FEBS 2721 EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄ threonine kinases and phosphatase in Mycobacterium tuberculosis Kirti ... kinase-associated protein phosphatase, a phosphoprotein-binding domain. Proc Natl Acad Sci USA 96, 7821–7826. 32 Chopra P, Singh A, Koul A, Ramachand...

Ngày tải lên: 16/03/2014, 14:20

... axis, all of the inter- actions reported below are repeated twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. Chain A Chain B ... protein is erucamide, but the shape and size of the cavity clearly indicate that inside the protein there is space for a roughly linear chain of about 22 carbon...

Ngày tải lên: 16/02/2014, 14:20

... Nakamura W, Hirano K, Yuasa H, Tsukamoto T & Tatematsu M (1998) Expression of sucrase and intestinal-type alkaline phosphatase in colorectal carcinomas in rats treated with methylazoxy- methanol ... molecular regulators responsible for intestinal epithelial establishment, determination and maturation is crucial to the provision of a better understanding of the intest...

Ngày tải lên: 29/03/2014, 21:20

... pivot language. Although only small amounts of bilingual data are available for the desired language pair L1-L2, large-scale bilin- gual corpora in L1-L3 and L2-L3 are available. Using these ... are available for the desired lan- guage pair L1-L2, large-scale bilingual corpora in L1-L3 and L2-L3 are available. Based on these two additional corpora and with L3 as the pivot l...

Ngày tải lên: 20/02/2014, 12:20

... general mechanism for furin-mediated activation of transmem- brane substrates. The activation of ADAM17 by furin [68] and our observation of an interaction between GRASP55 and the ICD of ADAM17 ... 3169 MT1-MMP and furin can interact with GRASP55. Overexpression of GRASP55 has been found to increase the amount of complex containing MT1- MMP and furin, and the expressio...

Ngày tải lên: 18/02/2014, 04:20

... ubiqui- tination. We have identified and characterized a signal- ling process involving Rac GTPase and a novel partner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes ... ubiquitination. Results Unkempt protein binds specifically to activated forms of RacGTPases In a two-hybrid screen for partners of activated RacGTPase, we isolated...

Ngày tải lên: 06/03/2014, 09:22

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... hae- matoxylin–phloxin–safran histological staining. For deter- mination of the number and minimal diameter of fibres, histochemical immunostaining with a...

Ngày tải lên: 07/03/2014, 03:20

... values over 0.75 are shown. Black geometrical shapes are additional domains, as indicated. ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachyda- nio rerio; CANDGLA, Candida glabrata; ... analyses of all splice variants link DIDO1 to other distantly related protein families involved in DNA binding and chromatin stability. Moreover, additional experimental data place the D...

Ngày tải lên: 07/03/2014, 21:20

... aggregation kinetics is triphasic, with an inital lag phase, followed by an exponential growth phase and ending with a steady state phase [4]. Figure 1A and C illustrate that a decrease in protein ... Strikingly, however, the lag phases of both WT and A5 3T a- synucleins and the elongation rates remain constant. One expects a dramatic increase of the lag phase...

Ngày tải lên: 16/03/2014, 22:20

... CATCTTCTCAAAATTCGAGTGACAA Reverse: TGGGAGTAGACAAGGTACAACCC RTPrimerDB 147 TTP Forward: TGCAATAACCCATTTCCCTGGTGC Reverse: TAGGAACGGATCCACCCAAACACT – TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAG Reverse: AGGCTGCTTTGATGTCTTCGGTTG – HuA ... database GAPDH Forward: TTCACCACCATGGAGAAGGC Reverse: GGCATGGACTGTGGTCATGA RTPrimerDB 2920 FXR1 Forward: ATAATTGGCAACCAGAACGCCAGG Reverse: CCACATGGCTCTTGGTCATTTGCT...

Ngày tải lên: 22/03/2014, 21:21