Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... Authors Journal compilation ª 2006 FEBS 2721 EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄ threonine kinases and phosphatase in Mycobacterium tuberculosis Kirti ... kinase-associated protein phosphatase, a phosphoprotein-binding domain. Proc Natl Acad Sci USA 96, 7821–7826. 32 Chopra P, Singh A, Koul A, Ramachand...
Ngày tải lên : 16/03/2014, 14:20
  • 11
  • 402
  • 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... axis, all of the inter- actions reported below are repeated twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. Chain A Chain B ... protein is erucamide, but the shape and size of the cavity clearly indicate that inside the protein there is space for a roughly linear chain of about 22 carbon...
Ngày tải lên : 16/02/2014, 14:20
  • 10
  • 768
  • 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... Nakamura W, Hirano K, Yuasa H, Tsukamoto T & Tatematsu M (1998) Expression of sucrase and intestinal-type alkaline phosphatase in colorectal carcinomas in rats treated with methylazoxy- methanol ... molecular regulators responsible for intestinal epithelial establishment, determination and maturation is crucial to the provision of a better understanding of the intest...
Ngày tải lên : 29/03/2014, 21:20
  • 13
  • 359
  • 0
Tài liệu Báo cáo khoa học: "Word Alignment for Languages with Scarce Resources Using Bilingual Corpora of Other Language Pairs" pptx

Tài liệu Báo cáo khoa học: "Word Alignment for Languages with Scarce Resources Using Bilingual Corpora of Other Language Pairs" pptx

... pivot language. Although only small amounts of bilingual data are available for the desired language pair L1-L2, large-scale bilin- gual corpora in L1-L3 and L2-L3 are available. Using these ... are available for the desired lan- guage pair L1-L2, large-scale bilingual corpora in L1-L3 and L2-L3 are available. Based on these two additional corpora and with L3 as the pivot l...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 359
  • 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... general mechanism for furin-mediated activation of transmem- brane substrates. The activation of ADAM17 by furin [68] and our observation of an interaction between GRASP55 and the ICD of ADAM17 ... 3169 MT1-MMP and furin can interact with GRASP55. Overexpression of GRASP55 has been found to increase the amount of complex containing MT1- MMP and furin, and the expressio...
Ngày tải lên : 18/02/2014, 04:20
  • 18
  • 603
  • 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

... ubiqui- tination. We have identified and characterized a signal- ling process involving Rac GTPase and a novel partner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes ... ubiquitination. Results Unkempt protein binds specifically to activated forms of RacGTPases In a two-hybrid screen for partners of activated RacGTPase, we isolated...
Ngày tải lên : 06/03/2014, 09:22
  • 12
  • 432
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... hae- matoxylin–phloxin–safran histological staining. For deter- mination of the number and minimal diameter of fibres, histochemical immunostaining with a...
Ngày tải lên : 07/03/2014, 03:20
  • 16
  • 428
  • 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... values over 0.75 are shown. Black geometrical shapes are additional domains, as indicated. ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachyda- nio rerio; CANDGLA, Candida glabrata; ... analyses of all splice variants link DIDO1 to other distantly related protein families involved in DNA binding and chromatin stability. Moreover, additional experimental data place the D...
Ngày tải lên : 07/03/2014, 21:20
  • 7
  • 658
  • 0
Báo cáo khoa học: PA700, the regulatory complex of the 26S proteasome, interferes with a-synuclein assembly pptx

Báo cáo khoa học: PA700, the regulatory complex of the 26S proteasome, interferes with a-synuclein assembly pptx

... aggregation kinetics is triphasic, with an inital lag phase, followed by an exponential growth phase and ending with a steady state phase [4]. Figure 1A and C illustrate that a decrease in protein ... Strikingly, however, the lag phases of both WT and A5 3T a- synucleins and the elongation rates remain constant. One expects a dramatic increase of the lag phase...
Ngày tải lên : 16/03/2014, 22:20
  • 11
  • 398
  • 0
Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

... CATCTTCTCAAAATTCGAGTGACAA Reverse: TGGGAGTAGACAAGGTACAACCC RTPrimerDB 147 TTP Forward: TGCAATAACCCATTTCCCTGGTGC Reverse: TAGGAACGGATCCACCCAAACACT – TIA-1 Forward: TTGTCAGCACACAGCGTTCACAAG Reverse: AGGCTGCTTTGATGTCTTCGGTTG – HuA ... database GAPDH Forward: TTCACCACCATGGAGAAGGC Reverse: GGCATGGACTGTGGTCATGA RTPrimerDB 2920 FXR1 Forward: ATAATTGGCAACCAGAACGCCAGG Reverse: CCACATGGCTCTTGGTCATTTGCT...
Ngày tải lên : 22/03/2014, 21:21
  • 12
  • 358
  • 0

Xem thêm