Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
... caspase-3activation, as they do not suppress the activation ofcaspase-3 mediated by heat shock. In mammalian cells, one of the main pathways thatactivates procaspase-3 is via mitochondria. ... pathway. ResultsHsp10 5a and Hsp105 b suppress apoptosis induced by H2O2but not by heat shock in HeLa cells Previously, we have established human HeLa cell lines (HeLa- tet ⁄ Hsp10 5a and HeLa- tet ⁄ Hsp105b) in ... necessary to clarify the targets of p38 MAPKsignaling in HeLa cells treated with H2O2. Apoptosis signal-regulating kinases (ASKs) areserine ⁄ threonine kinases that activate both the p38 MAPK...
- 13
- 215
- 0
Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt
... retardation and exagger-ated production of the pro -in ammatory cytokinetumour necrosis factor -a, without affecting basal HSPexpression [38]. Although HSF1 gains DNA-bindingand transactivating abilities ... transcriptional activators because it canbypass a need for critical general transcription factorsand co-activators, including general transcription fac-tor IIA (TFIIA) [31], Kin28 (a C-terminal-domainkinase ... Phosphorylation of HSF,regulated by heat and oxidative stress, is involved in the activation and inactivation of the transactivatingability [26]. Interestingly, Saccharomyces HSF is unu-sual among...
- 10
- 565
- 0
Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf
... (forward) GAGATCATCAAGCCCACCACAAC 112Hsp40 (reverse) CGGGAAACTTAATGTCGAAGGAGACHsp60 (forward) ACATCTCGCCGTACTTCATCAACTC 66Hsp60 (reverse) GGAGGAGGGCATCTTGGAACTCHsp67Ba (forward) TGGATGAACCCACACCCAATC ... TGGATGAACCCACACCCAATC 89Hsp67Ba (reverse) CGAGGCAACGGGCACTTCHsp68 (forward) GAAGGCACTCAAGGACGCTAAAATG 88Hsp68 (reverse) CTGAACCTTGGGAATACGAGTGHsp70Aa (forward) TCGATGGTACTGACCAAGATGAAGG 98Hsp70Aa (reverse) ... GAGTCGTTGAAGTAGGCTGGAACTGHsc70-1 (forward) TGCTGGATGTCACTCCTCTGTCTC 87Hsc70-1 (reverse) TGGGTATGGTGGTGTTCCTCTTAATCHsp83 (forward) GGACAAGGATGCCAAGAAGAAGAAG 150Hsp83 (reverse) CAGTCGTTGGTCAGGGATTTGTAGFig....
- 12
- 388
- 0
Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt
... shock transcription factor family Noritaka Yamamoto1, Yukiko Takemori1, Mayumi Sakurai2, Kazuhisa Sugiyama2and Hiroshi Sakurai11 Department of Clinical Laboratory Science, Kanazawa University ... generation,Keywordscrystallin; heat shock element; heat shock protein; heat shock response; heat shock transcription factorCorrespondenceH. Sakurai, Department of ClinicalLaboratory Science, Kanazawa UniversityGraduate ... mm. Samples were subjected to SDS ⁄ PAGEand immunoblot analysis using an antibody against VP16(Abcam, Cambridge, UK).Yeast strains, immunoblot analysis, and RT-PCRYeast strain HS126 (MATa ade2...
- 13
- 507
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... repeats from human tenascinstudied through a sequence frame-shift approachFrancesco Zanuttin, Corrado Guarnaccia, Alessandro Pintar and Sa´ndor PongorInternational Centre for Genetic Engineering ... Hoffman, S., Cunningham, B .A. & Edelman, G.M.(1989) A detailed structural m odel of cytotact in: protein homo-logies, alternative RNA splicing, and binding regions. Proc. NatlAcad. Sci. USA ... by standard stepwise solid-phase procedure on a 0.1-mmol scale. In f3, an Ala residue was inserted instead ofIle at the N-terminus and an extra Ser residue was added atthe C-terminus to avoid...
- 12
- 416
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV ... findings indicate that bothpalmitoylated and nonpalmitoylated mammalian Hh proteins can act as signaling molecules. It is nota-ble that while cholesterylation of Hh protein is anintramolecular event ... cocktail tablets (Roche Diagnostics, Indianapolis, IN, USA). Each sample was analyzed using a bicinchoninic acidprotein assay kit (Pierce, Rockford, IL, USA), and 30–50 lgof cellular protein was...
- 14
- 499
- 0
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
... fromsulfonoquinovosyl diacylglycerols of sea urchin. Trans-plantation 74, 261–267.3 Mizushina Y, Watanabe I, Ohta K, Takemura M,Sahara H, Takahashi N, Gasa S, Sugawara F, Matsuk-age A, Yoshida S & ... transcriptase type 1 from a marine red alga,Gigartina tenella. Chem Pharm Bull (Tokyo) 46, 684–686.5 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugaw-ara F, Matsukage A, Yoshida S & Sakaguchi ... DNAsequence analysis A biotinylated derivative of SQAG was immobilized on a Streptavidin-coated ELISA plate (Nalge Nunc International,S. Aoki et al. A molecular target of SQAGsFEBS Journal 272 (2005)...
- 9
- 891
- 0
Báo cáo khoa học: Mammalian xanthine oxidoreductase – mechanism of transition from xanthine dehydrogenase to xanthine oxidase pdf
... cofactors are located in the C-terminal85 kDa, N-terminal 20 kDa and intermediate 40 kDa domains, respectively [24,35,36]. The oxidation of xan-thine takes place at the molybdenum center, and ... of hypoxanthine to xanthine or xanthine to uricacid in the metabolic pathway of purine degradation in higher animals [1,2]. In humans, the enzyme is thetarget of therapeutic drugs against hyperuricemia ... 31037–31045.78 Terao M, Kurosaki M, Barzago MM, Varasano E,Boldetti A, Bastone A, Fratelli M & Garattini E (2006)Avian and canine aldehyde oxidase. Novel insights intothe biology and evolution...
- 12
- 355
- 0
Báo cáo khoa học: Mammalian glutaminyl cyclases and their isoenzymes have identical enzymatic characteristics docx
... pPICZaA6 ATATATGCGGCCGCCTAGTGATGGTGATGGTGATGGAGCCCCAGGTATTCAGCCAG7 ATATGAATTCCATCACCATCACCATCACTTCTACACCATTTGGAGCGGC Cloning of isoQC(F48)N-His into pPICZaA8 ATATATGCGGCCGCCTAGAGCCCCAGGTATTCAGC9 ... ATATATGCGGCCGCCTAGAGCCCCAGGTATTCAGC9 ATATGAATTCCATCACCATCACCATCACGAGGAGCTGCCGCTGGGCCG Cloning of isoQC(E60)N-His10 ATATGAATTCGAGGAGATGTCACGGAGC Cloning of murine isoQC(E61)into pPICZaA11 ATATATGCGGCCGCCTAGAGTCCCAGGTACTCGGC12 ... ATATATGCGGCCGCCTAGAGTCCCAGGTACTCGGC12 GATCTGCGGGTCCCGCTGAACGGAAGCCTTTCAGAAGCC Introduction of an N-glycosylation site13 GGCTTCTGAAAGGCTTCCGTTCAGCGGGACCCGCAGATC14 ATATGAATTCCATCACCATCACCATCACGAGGAGATGTCACGGAGCCGC...
- 15
- 284
- 0
Báo cáo khoa học: Mammalian initiator apoptotic caspases ppt
... 5445Frequent inactivating mutations of caspase-8 havebeen reported in advanced colorectal carcinomas [183],hepatocellular carcinomas [184], gastric carcinomas[185] and in a single head and neck carcinoma ... domains(DEDs) in their prodomains, and are also apoptotic family members.Caspases-3, -6, -7 and -14 have short prodomains and are effectorcaspases in the apoptotic pathway. P K. Ho and C. J. Hawkins Mammalian ... pro-caspase-12 that carries a read -through mutation at amino acid position 125, due to a natural polymorphism in some Africans[72]. Mammalian initiator apoptotic caspases P K. Ho and C. J. Hawkins5438...
- 18
- 158
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP