Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... domain plays a central role in bundling of F -actin. Taken together, these data identify hhLIM as an actin -binding protein that increases actin cytoskeleton stability by promoting bundling of actin ... data presented here demonstrate that human heart LIM protein (hhLIM) is an actin -binding protein that participates in remodeling of the actin cytoskeleton,...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAAC...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers pptx
... Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers Olga S. Ostroumova 1 , Ludmila V. Schagina 1 , Mark I. Mosevitsky 2 and Vladislav V. Zakharov 2 1 Laboratory of ... conductance and ion selectivity [21,22]. BASP1 (brain acid-soluble protein- 1; also known as cortical cytoskeleton- associated protein CAP-23 and neuronal tissue-enriched acidic protein NAP-2...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. Transcription factor SAF-3 is expressed during in ammation FEBS ... protein and increase its DNA -binding and transactivating func- tions. The SAF-1 DNA -binding and transcriptional activity is significantly increased in response to me...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx
... gagt … ccac ag GGATGT 1.4 3 105 a TAACAG gt aata … ttcc ag ACGTAT 6.5 4 250 TATCTG gt atgt … taac ag GATATG 0.89 5 120 ACGGAG gt aaaa … tccc ag CAACTC 1.7 6 138 GTTTTG gt aaga … attt ag GGCAGT 0.52 7 117 ... 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT 1.2 7 117 CATTAT gt aagt … tttc ag GATATT 0.17 8 16...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... immunostaining in spi- nal cord dorsal neurons was expressed using arbitrary units. Mouse Vgf radio immuno assay (RIA) C-terminal specific Vgf antibody (ab5901) was used in RIA analysis as previously ... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... is the His residue that in NirS is the proximal axial ligand to the d 1 heme. Replacement of an equivalent His, His41, in NirF by Ala abolished binding of the heme to the protein. Known distal ... Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H,...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
... nuclear factor of activated T cells; MTA, methylthioadenosine; NIP45, NFAT interacting protein 45kDa; PMA, 4b-phorbol 12-myristate 13-acetate; PRMT, protein arginine methyltransferase; SAH, S-adenosylhomocysteine; ... against a cellular PRMT substrate [8]. Computational modeling suggested that AMI-1 spans the SAM -binding and arginine -binding pockets of PRMT1; however, AMI-1 did not...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... cell lines and tissues using Trizol (Invitrogen, Carlsbad, CA, USA) reagent following the manufacturer’s instuctions. Total RNA was digested with RNAase-free DNase I (TaKaRa Carlsbad, CA, USA) at ... resulted in only one amino acid change in the predicted protein sequence from (Gln, 757CAG) in Nanog and (His, 757CAC) in NANOGP8. Since NANOGP8 has an intact open-reading fragment, so...
Ngày tải lên: 07/03/2014, 12:20