Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf
... Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet Xiaomei Gu 1, *, Zuoquan Xie 2, *, Qi Wang 1, *, Gang ... caused by an HFD. In addition, we found no significant alterations in the levels of alanine aminotransferase, aspartate amino- transferase or creatinine kina...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice pdf
... conditions, indicating crosstalk between auxin and abiotic stress signaling. Abbreviations ABA, abscisic acid; ARF, auxin response factor; AuxRE, auxin-responsive element; dap, days after pollination; ... understanding of the molecu- lar mechanisms of auxin signaling pathways. These F-box proteins are components of E3 ligase and target Aux ⁄ IAAs, in particular for degradation throu...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: "Error Profiling: Toward a Model of English Acquisition for Deaf Learners" ppt
... de- scribed, these two processes can proceed on the combination of the data contained in the previous utterances supplied by a given learner and the in- tuitions” granted by information on typical learn- ers, ... undertaken is meant to provide this structure by indicating a partial ordering on the acquisition of grammatical features by this popu- lation of learner...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo khoa học: Transcript profiling during the early development of the maize brace root via Solexa sequencing pot
... derivation of an accurate measure of gene expression, both individually and comprehensively, and the discovery of novel regions of transcription, dramatically changing the way that the functional ... D, Van Montagu M, Inze D & Beeckman T (2004) Transcript profiling of early lateral root initiation. Proc Natl Acad Sci USA 101, 5146–5151. 22 Inukai Y, Sakamoto T, Ueguchi-Ta...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Expression profiling reveals differences in metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy pot
... maladaptive and adap- tive cardiac hypertrophy. Exercise training increases the functional capacity of the cardiovascular system. The adaptations include increases in cardiac mass and dimension, ... Williams SP, Ogasawara A, Shimada B, Williams PM, de Feo G & Paoni NF (2001) Effects of early angiotensin-converting enzyme inhibition on cardiac gene expression after acute m...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Glycan profiling of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues ppt
... cathep- sin A in galactosialidosis patients, resulting in insufficient protection of b-galactosidase and a- neur- aminidase against excessive intra-lysosomal degrada- tion [2]. Cathepsin A is one of four ... enzymes in a lysosomal multi-enzyme complex comprising N-acetyl- galactosamine-6-sulfate sulfatase, b-galactosidase, cathepsin A and a- neuraminidase [3,4]. The enzym...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... parame- ters are calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro- file above the HST, the total area (the HST being the zero axis) and the area ... scoring matrix (the value for each amino acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). A...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf
... ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAA TCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTG TCTAAATGCCTTAAGTCCTTGTGTAAGGGACG TATC, ... 5¢-GCGAGG ACCAAGGGGATTCTGGAGCTGAACAAGGTGC AATTGTTGTACGAACAGGTGTGCCAGTCCTCC...
Ngày tải lên: 30/03/2014, 15:20
Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc
... proportionality of the assays. In nearly all cases, the rate was proportional to the amount of extract for at least two or three dilutions and only these data points were used for further calcula- tions. ... specificity of autophagy may depend on the kinetics of uptake by the vacuole and on the sensitivi- ties of proteins to vacuolar proteases [40], which again ma...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: "Predicate Argument Structure Analysis using Transformation-based Learning" pdf
... Japan {taira,sanae}@cslab.kecl.ntt.co.jp nagata.masaaki@lab.ntt.co.jp Abstract Maintaining high annotation consistency in large corpora is crucial for statistical learning; however, such work is hard, especially for tasks containing ... Transformation-based Learning Hirotoshi Taira Sanae Fujita Masaaki Nagata NTT Communication Science Laboratories 2-4, Hikaridai, Seika-cho, Souraku-gun, Kyo...
Ngày tải lên: 20/02/2014, 04:20