Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... the < /b> major bands,
coinciding with the < /b> appearance of < /b> a < /b> significant deacyla-
tion activity. Any bacterial contamination of < /b> our
protein preparations that might be responsible for acti-
vation of < /b> the < /b> ... suggest a < /b> role in the < /b> defence
against invading microorganisms and in the < /b> generation of < /b> lipid mediators
of < /b> i...
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx
... of < /b> m ⁄ z 8859, 8802 and
7521 appearing (Fig. 4B) . To obtain a < /b> preliminary
correlation of < /b> observed masses with hydrophobin
data, we again calculated from the < /b> available sequence
data sets of < /b> masses ... (Table 2).
On the < /b> basis of < /b> confirmed structural data of < /b> H. jecorina
HFB1, HFB2 and HFB3, we here predict the < /b> presence
and cleavage p...
Báo cáo khoa học: Molecular identification of monomeric aspartate racemase from Bifidobacterium bifidum pptx
... of < /b> both
enantiomers of < /b> the < /b> amino acid. As shown in T able 2, the < /b> K
m
AB
Fig. 1. SDS/PAGE of < /b> aspartate racemase from B. bifidum (A)< /b> and the
< /b> recombinant enzyme (B) . (A)< /b> L ane M, the < /b> molecular marker ... peptidoglycans [5]. The
< /b> cross-linker moieties of < /b> B. bifidum contain
D
-aspartate as
the < /b> essential component...
Báo cáo khoa học: "Distributional Identification of Non-Referential Pronouns" pdf
... 94301
lindek@google.com
Randy Goebel
Department of < /b> Computing Science
University of < /b> Alberta
Edmonton, Alberta
Canada, T6G 2E8
goebel@cs.ualberta.ca
Abstract
We present an automatic approach to deter-
mining whether a < /b> ... Bergsma
Department of < /b> Computing Science
University of < /b> Alberta
Edmonton, Alberta
Canada, T6G 2E8
bergsma@cs.ualberta.ca
Dekang Lin
Google, In...
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc
... 5¢-GGA
ATTCTAGATATCGTCGACAATTTGTGTTACTACC
AAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAA
AAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGG
GIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACC
TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA
ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG
GCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTC
GACTTATCTTCAGAACTTGTTGC-3¢; ... 5¢-CGGGATC
CGGTGGCGACGACTCCTGGAGCCC-3¢;PR,5¢-CG
GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢;
P...
Báo cáo khoa học: Structural identification of ladderane and other membrane lipids of planctomycetes capable of anaerobic ammonium oxidation (anammox) pptx
... sil-
ylated with BSTFA and analysed by GC. An internal
standard was added to an aliquot of < /b> the < /b> acetone-fraction
and analysed by GC and GC ⁄ MS after silylation. The
< /b> remaining part of < /b> the < /b> acetone fraction ... ‘Scalindua wagneri’, identified in a < /b> wastewater
treatment plant treating landfill leachate [8].
Anammox catabolism takes place in a < /b> sepa...
Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx
... dithio-
threitol. The < /b> apo-rIZA1 obtained mobilized as a < /b> single
band in SDS ⁄ PAGE and did not contain any heme absorb-
ance in the < /b> Soret region. The < /b> binding of < /b> heme to apo-
rIZA1 was monitored by adding dropwise ... myoglobin which has
His as the < /b> fifth ligand for heme iron, the < /b> ligand of
< /b> IZA may not be a < /b> single amino acid. Rath...
Báo cáo khoa học: "Language Identification of Search Engine Queries" pdf
... bottleneck by automat-
ically generating a < /b> data set of < /b> queries with lan-
guage annotations. We show that the < /b> data gener-
ated this way is highly reliable and can be used to
train a < /b> machine learning algorithm.
We ... word in a < /b> given text can be calculated by
using rank-order statistics or by transforming the
< /b> frequencies into probabilities.
The < /b...
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... At present, in many ICUs
CXRs are still routinely obtained on a < /b> daily basis, at least in The
< /b> Netherlands [13].
There may be advantages to eliminating daily routine CXRs.
First, a < /b> routine strategy ... (1.5%)
Predefined major abnormalities are summarized in Table 1.
a
< /b> Absolute number of < /b> chest radiographs (% of < /b> all daily routine chest radiographs)...
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... distal to the < /b> E2F ⁄ CDE acts as an
activating element binding E2F1, -2 and -3. These acti-
vating E2Fs cooperate with NF-Y proteins binding to
CCAAT-boxes and with Myb proteins associating with
a < /b> ... distal Myb site in activating the < /b> Cdc2 promoter.
Binding of < /b> the < /b> activating E2Fs during the < /b> cell cycle to
the < /b> promoter alternates with binding...