Báo cáo khoa học: Dermaseptin DA4, although closely related to dermaseptin B2, presents chemotactic and Gram-negative selective bactericidal activities doc

Báo cáo khoa học: Dermaseptin DA4, although closely related to dermaseptin B2, presents chemotactic and Gram-negative selective bactericidal activities doc

Báo cáo khoa học: Dermaseptin DA4, although closely related to dermaseptin B2, presents chemotactic and Gram-negative selective bactericidal activities doc

... ª 2009 FEBS Dermaseptin DA4, although closely related to dermaseptin B2, presents chemotactic and Gram-negative selective bactericidal activities Constance Auvynet 1,2, *, Pierre Joanne 2, , ... of the DRS -DA4, DRS -B2, DDK, and DRS-L1. Hexagonal and round backgrounds refer to basic and acid amino acids respectively, pentagonal backgrounds to hydrop...

Ngày tải lên: 16/03/2014, 00:20

14 413 0
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

... 5¢-CTCGAGACAATACAATTGTCCAGG-3¢, and reverse primer 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and the PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then into pRSETB vector using XhoI and HindIII ... and 3), CD69NG70 (lanes 4 and 5), CD69NV82 (lanes 6 and 7) CD69NS84 (lanes 8 and 9), rat CD69 (lanes 10 and 11) and mouse CD69 (lanes 12 and 13) was...

Ngày tải lên: 16/03/2014, 04:20

18 400 0
Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

... of the toxin. The RelE clue Understanding the effect of the toxin on ColE1 and k replication and the protection of Kid toxicity by DnaB E. Diago-Navarro et al. parD ⁄ kid-kis Toxin-Antitoxin system FEBS ... prolifera- tion and viability. In both systems, the toxin was able to kill, whereas the antitoxin neutralized its action. To further analyse the effect of the toxin and the ant...

Ngày tải lên: 18/02/2014, 04:20

21 768 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... decision making connected to metritis treat- ment and potential links to data quality. This understand- ing provides insight into potential errors (bias and random error) related to data based on clinical ... drying off and at calving (5-21 days post partum). The mandatory screenings focus on general condition, metritis/vaginitis, mastitis and body condition. Optional screenin...

Ngày tải lên: 25/10/2012, 10:45

10 588 0
Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

... find more reliably patients who are in crisis, and then respond to them swiftly and effectively to prevent unnecessary deaths. In 1994, Franklin and Mathew [1] recognized that cardiac arrests ... recognized and treated, often death can be prevented. Medical emergency teams (MET) are a mechanism to fill this need. The epidemiology of patient deteriorations is not well understood....

Ngày tải lên: 25/10/2012, 10:45

2 442 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

... taxonomically restricted to ‘Homo sapiens’, the enzyme was set to ‘none’, and the mass error tolerances for precursor and fragment ions were typically set to 0.15 u for qTOF MS ⁄ MS and 50 p.p.m. and 1 u, respectively, ... signals with signal -to- noise ratio higher than 10 were automatically subjected to MALDI-LIFT-TOF ⁄ TOF MS ⁄ MS experiments by applying 2000 laser shots....

Ngày tải lên: 16/02/2014, 14:20

18 428 0
Tài liệu Báo cáo khoa học: Enzyme kinetics informatics: from instrument to browser pdf

Tài liệu Báo cáo khoa học: Enzyme kinetics informatics: from instrument to browser pdf

... experimental instrument, process and normalize it to agreed standards and finally transfer these data to publicly available data- bases to make them accessible. To facilitate the dissemination ... developed to advise on the mini- mum requirements to follow in the storage and dis- semination of experimental data in fields such as transcriptomics and proteomics, which will ult...

Ngày tải lên: 18/02/2014, 04:20

11 518 0
Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... core histones is associated with heat shock. This is achieved by HSF1 and the his- tone deacetylases HDAC1 and HDAC2 [77]. In heat- shocked cells, HSF1 binds to HDAC1 and HDAC2, and their histone-deacetylase ... (SWI ⁄ SNF, ISW1 and RSC) and histone chaperones (Asf1, Spt6 and Spt16), are involved in histone acetylation and eviction [52–55]. Stress-inducible or constitutive b...

Ngày tải lên: 18/02/2014, 04:20

10 565 0
Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

... negative regulators of CLOCK ⁄ BMAL1, the family of Period genes (Per1, Per2 and Per3), the Cryptochromes (Cry1 and Cry2) and Rev-Erb a [3,5,6]. Rev-Erba binds the BMAL1 promoter directly to inhibit ... phosphorylation and degradation of Per proteins have been suggested to control timing of the mammalian clock [8]. Moreover, BMAL1 and Cry proteins are subject to phosphorylatio...

Ngày tải lên: 18/02/2014, 06:20

9 481 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... Puf4 and Puf5 were shown to bind, respectively, to 56%, 26% and 49% of all known and putative 3¢ UTR sequences possessing the binding con- sensus identified [23]. The same strategy was used to identify ... (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ (reverse) to APUM-7. Qualitativ...

Ngày tải lên: 18/02/2014, 06:20

15 586 0
w