Considering the Creation of a Domestic Intelligence Agency in the United States pot

Considering the Creation of a Domestic Intelligence Agency in the United States pot

Considering the Creation of a Domestic Intelligence Agency in the United States pot

... Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida ... Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ASIO Australian Security Intelligence Organisatio...

Ngày tải lên: 15/03/2014, 21:20

218 375 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc 1 complex that finally leads to the ... were of analytical grade. Yeast strains and growth media The genotypes and sources of the S. cerevisiae strains are described in Table 2. The ISP deletion strain was...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Jap an. Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and 2-aminomuconic acid in the modified meta-cleavage path- way (Fig. 1B). The 2-aminomuconate deaminase from s train AP-3 and that from strain JS45 have been puri...

Ngày tải lên: 19/02/2014, 16:20

7 613 1
Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx

Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx

... via NTLK) of 0.74. Kappa between the primary annotator and a hypothetical “majority voter” of the three additional annotators was 0.90. These results were taken as moderate indication of the ... control plane. The material was a heavy canvas known as duck , and the brothers began making work pants and shirts out of the strong material. NN Digeri is the name...

Ngày tải lên: 16/03/2014, 19:20

9 347 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

... Registering, enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws. - Ensuring product quality in line with the registered standards, ... parties are familiar with available insurance policies, but it is too strict and necessary for an international transaction. Unless parties are assured that the coverage is availab...

Ngày tải lên: 18/04/2013, 08:57

41 617 0
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The lability of the a- proton observed ... N.N. & Braunstein, A. E. (1947) Labilization of a- hydrogen of amino acids under the action of aminoferase. Biokhimia 12, 556–568 (in Ru...

Ngày tải lên: 19/02/2014, 16:20

7 533 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... b-lactam antibiotics are located on the outer side of the inner membrane of bacteria, b-lactams do not have to pass the inner membrane to be active. Amoxicillin inhibits thegro...

Ngày tải lên: 21/02/2014, 15:20

12 598 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

... [16]. The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS. Permethylation ... Hep3-glycoforms were obtained in an analogous manner (data not shown) and for all glycoforms the hexoses were found to be members of a linear chain attach...

Ngày tải lên: 08/03/2014, 02:21

13 433 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da. The total calculated average molecular mass ... redox state of the cell (Table 1). These data also show that P. aeruginosa xdhC is able to participate in assembly of the C. acidovorans XDH in E. coli. The steady sta...

Ngày tải lên: 16/03/2014, 23:20

11 585 0
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

... hispa- nica was amplified using pET-AmyH as template, with primers AmyFor-NdeI (TTTGTTTAACTTTAAGAAGG AGATATA CATATGAATCG) and AmyRev-NcoI (aaaac catGGGCTTTGTTAGCAGCCGGAT). The amplified fragment was ... template, and prim- ers AmyH-T 7a (atat catATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (atat aagcttGTCTCCGTGGCG TGCCAGCTTACTG), and cloned into the NdeI and HindIII sites of plasmid pET2 1a...

Ngày tải lên: 23/03/2014, 06:20

9 414 0
w