the creation of a barren substrate
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... edit of the document greatly improved the final product Abbreviations AAT Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian ... demonstrated that they can rapidly alter their behavior and adapt their tactics in the face of CT pressure To keep pace with an agile threat, intelligence organizations must be able to adapt as well Large,...
- 218
- 375
- 0
Báo cáo khoa học: "The Creation of a Corpus of English Metalanguage" pptx
... Frequencies of each category in the subset labeled by additional annotators and the values of the Kappa statistic for binary relabelings The low value for remapped OM was expected, since the category was ... occurrences of the word which were associated with candidates identified as mentioned language For example, 80% of appearances of the verb call preceded a candidate instance that was labeled as mentioned ... error The exchange shown in Figure is representative of the reactions of nearly all dialog systems: in spite of the domain generality of metalanguage and the user’s expectation of its availability,...
- 9
- 347
- 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... concentrations were approximately doubled (194 lm p38 MAPKa, 549 lm ADP, 542 lm AMP-PCP) ATPase activity assay The ATPase activity of activated p38 MAPKa was characterized using the coupled assay ... obtained from the bisubstrate kinetics v A ¼ Vmax aKA þ KB þ IKB þ I þ A 1 þ aKB Á B KI B B bKI rearranged v B ¼ Vmax aKB þ KA þ IKA þ B þ aKA þ aKA I A KI A A bKI A ð2Þ MgADP We then ... recent years p38 MAPKa has emerged as a major practicable drug target, associated with several severe diseases of inflammation [3–5] The identification in 1994 of the pyridinyl class of p38 MAPKa inhibitors...
- 15
- 554
- 0
lepler - the many panics of 1837; people, politics, and the creation of a transatlantic financial crisis (2013)
... than half the value of America’s total exports.31 A diplomatic easing of Anglo-American trade relations in 1830 facilitated the importation of manufactured goods as well Growing American demand ... interpreting financial information had elevated him to partner in the Barings’ family firm In New Orleans, Baring and Bates explored the results of a financial transaction their bank had facilitated a quarter ... population of the trans-Appalachian West was greater than that of the entire United States in 1790.29 Public land sales in the five largest cotton-producing states – Arkansas, Alabama, Louisiana, Mississippi,...
- 358
- 324
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... more rapid turnover The kcat ⁄ Km values increase from G1P over PhyK to AppA by a factor of 2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate ... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...
- 13
- 766
- 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... present any activity on thiamin degradation Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial genomes was performed ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
- 9
- 491
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... plasmid The gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ ... the intention of adding these to Gambeta later if a great variation in behavior was seen between bB2 and Gambeta However, as this was not the case, the Gambeta variant incorporating L and N at ... L and E deriving from the XhoI restriction site Likewise, we also amplified the cDNA for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢,...
- 13
- 430
- 0
Báo cáo khoa học: "The decline of a Pinus nigra Arn. reforestation stand on a limestone substrate: the role of nutritional factors examined by means of foliar diagnosis" doc
... the aesthetic and landscape-planning point of view, but also as a guarantee of the ecological stability of the plantations and, as a conse- quence, of their ability to perform the functions they ... correlations; a variance analysis with ANOVA-LSD test and discriminant analysis were further performed The software used was Statistica Statsoft Inc and SPSS for Windows 6.0 RESULTS The data in table ... to establish that the majority of parameters (except needle length and the surface of the flat projection among the morphological parameters, and magnesium concentration among the chemical ones)...
- 10
- 395
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
- 23
- 1,290
- 1
List the components of a radio system
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
- 30
- 920
- 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
- 386
- 1,222
- 4
Guest the meaning of a word
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
- 2
- 871
- 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
- 6
- 692
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25