describe the role of a positive feedback loop in childbirth

... state may be maintained mainly by key amino acids. In this study, two point-mutated proteins each with a single base substitution [alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) ] and ... tryptophan at position 140 plays an important role in maintaining protein ter- tiary integrity. Figure 4A shows how tryptophan (loop 1) may interact with loop 2 and loop 3. These inter- actions ... Hueih-Min Chen 1 1 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC 2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of...

Ngày tải lên: 20/02/2014, 01:20

... 2002 Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 , Michael Kokkinidis 1,3 and Vassilis ... the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased E a value. The validity of the above interpretation was further reinforced ... exhibits an E a almost the same as in the case ofthenativeenzyme(Table1). Thermal inactivation of mutant and wild-type enzymes In order to investigate the effects of mutations on the stability of psychrophilic...

Ngày tải lên: 22/02/2014, 04:20

... semantic The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering Sanda Harabagiu, Dan Moldovan Marius Pas¸ca, Rada Mihalcea, Mihai Surdeanu, R ˘ azvan Bunescu, Roxana G ˆ ırju, ... lists the quantitative analysis of the feedback loops. Loop 1 was generated more often than any other loop. However, the small overall average number of feedback loops that have been carried out in- dicate ... if (a) a vol- cano IS -A mountain; (b) lava IS-PART of vol- cano, and moreover it is a part coming from the inside; and (c) fragments of lava have all the prop- erties of lava, the following question...

Ngày tải lên: 08/03/2014, 05:20

Ngày tải lên: 21/03/2014, 22:01

Ngày tải lên: 30/03/2014, 04:20

Ngày tải lên: 20/06/2014, 00:20

... an international transaction. Unless parties are assured that the coverage is available in the amount designated, the failure of a party to obtain insurance coverage should not be grounds for termination of ... is a certain moment of time wherein the ownership of the goods by the seller ceases and passes to the others and that of the buyer begins; that is called the transfer of title. In a certain aspect, ... between the involved parties. It can be seen as an obvious offer of the Seller to the Company in case of any goods damage arising out of the Company’s obligations such as damage during shipment, damage...

Ngày tải lên: 18/04/2013, 08:57

... consumed in place of saturated fatty acids. It is possible to increase the content of vitamin E, a natural antioxidant, and to insert the capability of producing plant-based omega-3 fatty acids into ... can be used to elevate levels of vitamins A, C, and D and folate; increase antioxidants; and enhance iron bioavailability in vegetables, fruits, and grains. It is also possible to increase the ... thousands of years since the domestication of plants and animals began. Classical breeding and selection, as well as techniques such as radiation breeding, embryo rescue, and transposon mutagenesis,...

Ngày tải lên: 25/10/2013, 21:20

... mitochon- drial respiratory chain, the assistance of specific chaperone proteins is also required. The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... were of analytical grade. Yeast strains and growth media The genotypes and sources of the S. cerevisiae strains are described in Table 2. The ISP deletion strain was prepared in accordance with the ... seen in the molecular mass of the bc 1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the...

Ngày tải lên: 18/02/2014, 08:20

... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Jap an. Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and 2-aminomuconic acid in the modified meta-cleavage path- way (Fig. 1B). The 2-aminomuconate deaminase from s train AP-3 and that from strain JS45 have been purified and characterized in detail [5,6]. The nucleotide ... not have an absorbance peak at 300 nm [5]. A cofactor is not required for t he enzyme activity. In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D -amino acid...

Ngày tải lên: 19/02/2014, 16:20

... best candidate for t he binding of the a- carboxylate group of the s ubstrate, when the external aldimine is formed. The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically ... defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The lability of the a- proton observed for a large number of amino acids [5] under the action of TPL ... groups of amino acid inhibitors mentioned above. The interaction of L -phenylalanine, L -methionine, and their a- deuterated analogs with TPL in D 2 O was charac- terized by the appearance of quinonoid...

Ngày tải lên: 19/02/2014, 16:20

... of labor, cheaper costs of transport to market, or other natural advantages. If another r egion is able to captur e the firm away from its optimal location b y offering lucrativ e financial incentiv es, ... dilute the risk of any one project in a diversified portfolio. There are several other advantages to innovation at large firms beyond financing and managing R&D. Large firms tend to have estab- lished ... SECOND QUARTER 2007 87 IV. SMALL BUSINESS AND INNOVATION Joseph Schumpeter, the renowned analyst and advocate of capital- ism, asserted that the hallmark of capitalism is innovation: The sweeping...

Ngày tải lên: 06/03/2014, 19:20

... obtained indicated that the clus- ter plays a crucial role in the stabilization of the quaternary, native assem- bly of the enzyme, although it is not located at the subunit interface. The analysis ... [6]. The central feature of the N-terminal, larger domain is a seven-stranded b-sheet. In some instances, the N-terminal tail does not partici- pate as a part of the large domain but comprises a separate ... (for a fraction ‡ 90%), the apo-L8 5A is approximately 75% dimeric, whereas the apo-L27 6A and the apo-L8 5A ⁄ L8 5A mutants are in the mono- meric state. The association state of the holoenzymes can...

Ngày tải lên: 07/03/2014, 03:20

... comparisons statistical analysis was performed using one-way analysis of variance ( ANOVA ) followed by a Newman–Keuls post-test. Data analysis was performed using GRAPHPAD PRISM software and ... Kono-Sugita, E., Sekihara, H., Aizawa, S., Cushman, S.W., Akanuma, Y., Yazaki, Y. & Kadowaki, T. (1997) Role of insulin receptor substrate-1 and pp60 in the regulation of insulin-induced glucose ... establish the importance of GSK3 in the acute regulation of glucose transport in terms of its regulatory control of GS in muscle and fat cells we have investigated the effects of Li and the anilinomaleimide,...

Ngày tải lên: 08/03/2014, 08:20

... head nods, hand-arm Ayano Sueyoshi and Debra M. Hardison, Department of Linguistics and Germanic, Slavic, Asian and African Languages. Ayano Sueyoshi is now affiliated with Okinawa International ... communication between Japanese and Americans—Focusing on the use of the eyes. Japan Association of Language Teachers Journal, 8, 109–118. Kagawa, H. (2001). Ambiguous Japanese. Tokyo: Koudansha International Publisher. Kellerman, ... (1981) examined the interaction of available visual cues in a story- retelling task with native speakers of English. A story was told to participants in four conditions, all with audio but varying in visual...

Ngày tải lên: 10/03/2014, 05:20

... feature of savings banks across the world is the fact that they maintain large branch networks, often in areas that commercial banks no longer serve. In many countries, savings banks are the ... organisations that have sprung out of the savings banks movement, have done a   Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of ... essential to collect the often small amounts of savings, and maintain them at the disposal of the client on a permanent basis. It requires skilled staff, good treasury management and adequate...

Ngày tải lên: 15/03/2014, 10:20

... Action] AFP Australian Federal Police AG Attorney-General AIC Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic ... Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ASIO Australian Security Intelligence Organisation ASIS Australian Secret Intelligence Service AUSTRAC Australian Transaction ... and Canada, ASIO derives much of this information from human sources. A certain amount of data emanates from well-placed informants and individuals who submit plea bargains during trials for...

Ngày tải lên: 15/03/2014, 21:20

... According to the sequence obtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular ... of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was established using the AlkPhos Direct ... using stepdown PCR [27] mediated by the forward primer xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as...

Ngày tải lên: 16/03/2014, 23:20

Ngày tải lên: 17/03/2014, 17:20

Ngày tải lên: 17/03/2014, 23:20