0

describe the role of a positive feedback loop in childbirth

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Báo cáo khoa học

... state may bemaintained mainly by key amino acids. In this study, two point-mutatedproteins each with a single base substitution [alanine for tryptophan(W14 0A) and alanine for lysine (K13 3A) ] and ... tryptophan at position140 plays an important role in maintaining protein ter-tiary integrity. Figure 4A shows how tryptophan (loop 1) may interact with loop 2 and loop 3. These inter-actions ... Hueih-Min Chen11 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of...
  • 7
  • 551
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Báo cáo khoa học

... 2002Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphataseKonstantinos Mavromatis1,*, Iason Tsigos2,*, Maria Tzanodaskalaki2, Michael Kokkinidis1,3and Vassilis ... the aromatic ring of Tyr269, and theseunfavorable interactions could lead to a decrease of localflexibility and an increased E a value. The validity of the above interpretation was furtherreinforced ... exhibits an E a almost the same as in the caseofthenativeenzyme(Table1).Thermal inactivation of mutant and wild-type enzymes In order to investigate the effects of mutations on the stability of psychrophilic...
  • 6
  • 488
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học

... semantic The Role of Lexico-Semantic Feedback in Open-Domain TextualQuestion-AnsweringSanda Harabagiu, Dan MoldovanMarius Pas¸ca, Rada Mihalcea, Mihai Surdeanu,R˘azvan Bunescu, Roxana Gˆırju, ... lists the quantitative analysis of the feedback loops. Loop 1 was generated more often than any other loop. However, the small overall average number of feedback loops that have been carried out in- dicate ... if (a) a vol-cano IS -A mountain; (b) lava IS-PART of vol-cano, and moreover it is a part coming from the inside; and (c) fragments of lava have all the prop-erties of lava, the following question...
  • 8
  • 508
  • 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

Kinh tế - Thương mại

... aninternational transaction. Unless parties are assured that the coverage is available in the amount designated, the failure of a party to obtain insurance coverage shouldnot be grounds for termination of ... is a certain moment of time wherein the ownership of the goods by the seller ceases and passes to the others and that of the buyer begins; that is called the transfer of title. In a certain aspect, ... between the involved parties. It can be seen as an obvious offer of the Seller to the Company in case of any goods damage arising out of the Company’s obligations such as damageduring shipment, damage...
  • 41
  • 614
  • 0
The Role of Genetically Modified Organisms (GMOs) in Beverage Production

The Role of Genetically Modified Organisms (GMOs) in Beverage Production

Môi trường

... consumed in place of saturated fattyacids. It is possible to increase the content of vitamin E, a natural antioxidant,and to insert the capability of producing plant-based omega-3 fatty acidsinto ... can be used to elevate levels of vitamins A, C,and D and folate; increase antioxidants; and enhance iron bioavailability in vegetables, fruits, and grains. It is also possible to increase the ... thousands of years since the domestication of plants and animals began. Classicalbreeding and selection, as well as techniques such as radiation breeding,embryo rescue, and transposon mutagenesis,...
  • 6
  • 498
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Báo cáo khoa học

... mitochon-drial respiratory chain, the assistance of specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... were of analytical grade.Yeast strains and growth media The genotypes and sources of the S. cerevisiae strains aredescribed in Table 2. The ISP deletion strain wasprepared in accordance with the ... seen in the molecular mass of the bc1complex in these two deletion strains, thus leading to the hypothesisthat the addition of ISP may play a pivotal role in the structural rearrangement of the...
  • 15
  • 639
  • 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Báo cáo khoa học

... [6,8,27] or toany other sequences available in FASTA and BLASTdatabase programs at the DNA Data Bank of Jap an.Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and2-aminomuconic acid in the modified meta-cleavage path-way (Fig. 1B). The 2-aminomuconate deaminase from s trainAP-3 and that from strain JS45 have been purified andcharacterized in detail [5,6]. The nucleotide ... not have anabsorbance peak at 300 nm [5]. A cofactor is not requiredfor t he enzyme activity. In contrast, the deaminase fromstrain 10d contained an FAD-like cofactor, similar toD-amino acid...
  • 7
  • 613
  • 1
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Báo cáo khoa học

... best candidate for t he binding of the a- carboxylate group of the s ubstrate, when the external aldimine is formed. The anchoring of a- carboxylateand a- amino group in the external aldimine definesautomatically ... definesautomatically the positions of the a- proton and the sidechain of any bound amino ac id. The lability of the a- protonobserved for a large number of amino acids [5] under the action of TPL ... groups of amino acid inhibitors mentioned above. The interaction of L-phenylalanine,L-methionine, andtheir a- deuterated analogs with TPL in D2O was charac-terized by the appearance of quinonoid...
  • 7
  • 532
  • 0
The Role of Small and Large Businesses in Economic Development doc

The Role of Small and Large Businesses in Economic Development doc

Tài chính doanh nghiệp

... of labor, cheaper costs of transport to market, or other natural advantages. Ifanother region is able to capture the firm away from its optimal locationby offering lucrative financial incentives, ... dilute the risk of any one project in a diversified portfolio. There are several other advantages to innovation at large firmsbeyond financing and managing R&D. Large firms tend to have estab-lished ... SECOND QUARTER 2007 87IV. SMALL BUSINESS AND INNOVATIONJoseph Schumpeter, the renowned analyst and advocate of capital-ism, asserted that the hallmark of capitalism is innovation: The sweeping...
  • 25
  • 660
  • 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

Báo cáo khoa học

... obtained indicated that the clus-ter plays a crucial role in the stabilization of the quaternary, native assem-bly of the enzyme, although it is not located at the subunit interface. The analysis ... [6]. The central feature of the N-terminal, larger domain is a seven-stranded b-sheet. In some instances, the N-terminal tail does not partici-pate as a part of the large domain but comprises a separate ... (for a fraction ‡ 90%), the apo-L8 5A isapproximately 75% dimeric, whereas the apo-L27 6A and the apo-L8 5A ⁄ L8 5A mutants are in the mono-meric state. The association state of the holoenzymescan...
  • 12
  • 578
  • 0
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Báo cáo khoa học

... comparisons statistical analysis was performedusing one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test. Data analysis was performedusingGRAPHPAD PRISMsoftware and ... Kono-Sugita, E., Sekihara, H.,Aizawa, S., Cushman, S.W., Akanuma, Y., Yazaki, Y. &Kadowaki, T. (1997) Role of insulin receptor substrate-1 and pp60 in the regulation of insulin-induced glucose ... establish the importance of GSK3 in the acute regulation of glucose transport in terms of itsregulatory control of GS in muscle and fat cells we haveinvestigated the effects of Li and the anilinomaleimide,...
  • 10
  • 804
  • 0
The Role of Gestures and Facial Cues in Second Language Listening Comprehension pptx

The Role of Gestures and Facial Cues in Second Language Listening Comprehension pptx

Kỹ năng nghe tiếng Anh

... head nods, hand-armAyano Sueyoshi and Debra M. Hardison, Department of Linguistics andGermanic, Slavic, Asian and African Languages.Ayano Sueyoshi is now affiliated with Okinawa International ... communicationbetween Japanese and Americans—Focusing on the use of the eyes.Japan Association of Language Teachers Journal, 8, 109–118.Kagawa, H. (2001). Ambiguous Japanese. Tokyo: Koudansha InternationalPublisher.Kellerman, ... (1981)examined the interaction of available visual cues in a story-retelling task with native speakers of English. A story was toldto participants in four conditions, all with audio but varying in visual...
  • 39
  • 919
  • 2
Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx

Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx

Ngân hàng - Tín dụng

... feature of savings banks across the world is the fact that they maintain large branch networks, often in areas that commercial banks no longer serve. In many countries, savings banks are the ... organisations that have sprung out of the savings banks movement, have done a Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of ... essential to collect the often small amounts of savings, and maintain them at the disposal of the client on a permanent basis. It requires skilled staff, good treasury management and adequate...
  • 4
  • 511
  • 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot

Considering the Creation of a Domestic Intelligence Agency in the United States pot

Khoa học xã hội

... Action]AFP Australian Federal PoliceAG Attorney-GeneralAIC Australian intelligence communityANAO Australian National Audit OfficeAQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic ... Islamic Maghreb]ASALA Armenian Secret Army for the Liberation of ArmeniaASIO Australian Security Intelligence OrganisationASIS Australian Secret Intelligence ServiceAUSTRAC Australian Transaction ... and Canada, ASIO derives much of this information from human sources. A certain amount of data emanates from well-placed informants and individuals who submit plea bargains during trials for...
  • 218
  • 375
  • 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học

... According to the sequenceobtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated averagemolecular ... of the xdhA gene(ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene(gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was established using the AlkPhosDirect ... using stepdown PCR [27] mediated by the forward primerxb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtcagaactct), the reverse primer xa100– (5¢-gtggtgaattcagccagtgtgcccttg), and pNIall2 as...
  • 11
  • 584
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008