Báo cáo khoa học: "Finding Word Substitutions Using a Distributional Similarity Baseline and Immediate Context Overlap" potx

... the head‘rescue’, and lemma:failing arg:ARG1 var:bankwhich indicates that the argument of ‘failing’ is‘bank’.Note that any tree can be transformed into a feature for a particular lexical item ... that combine both pattern-based and feature vector approaches have alsobeen presented. Lin et al. (2003) and Pantel and Ravichandran (2004) have proposed to classify theoutput of systems based ... a clause as second argument (‘to say a word , ‘tosay that the word is ’).4 A Baseline We describe here our baseline, a system based on distributional similarity. 4.1 Step 1 - Pattern-Based Pair...

Báo cáo khoa học: "Finding Cognate Groups using Phylogenies" ppt

... Latin ancestor, parameterized by transformations ϕ and survival variables S. Languages shownare Latin (LA), Vulgar Latin (VL), Proto-Iberian (PI), Italian (IT), Portuguese (PT), and Spanish ... and Malay, tosee if similar patterns hold there, too.Some authors have attempted to automaticallydetect cognate words (Mann and Yarowsky, 2001;Lowe and Mazaudon, 1994; Oakes, 2000; Kon-drak, ... distance: Application in handwrittencharacter recognition. Pattern Recognition, 39(9).Don Ringe, Tandy Warnow, and Ann Taylor. 2002.Indo-european and computational cladistics. Trans-actions...

Báo cáo khoa học: "Accurate Collocation Extraction Using a Multilingual Parser" docx

... candidatepairs are chosen from a large search space. Tocope with this problem, a candidate pair is usu-ally chosen so that both words are inside a context (‘collocational’) window of a small ... doneat the end of the extraction process, but separatelyfor each stage: after the candidate selection stage,for evaluating the quality (in terms of grammati-cality) of candidates proposed; and ... collocation candidates are iden-tiﬁed from the text corpora, based on criteriawhich are speciﬁc to each system;II. in stage two, the candidates are scored and ranked using speciﬁc association measures(a...

Báo cáo khoa học: "Fast Semantic Extraction Using a Novel Neural Network Architecture" docx

... solutions are compli-cated, consist of several stages and hand-built features, and are too slow to be appliedas part of real applications that require suchsemantic labels, partly because of ... locational or temporalinformation relative to some verb.Shallow semantic parsing has immediate applica-tions in tasks such as meta-data extraction (e.g. fromweb documents) and question and answer ... is labeled foreach particular verb as so-called frames. Addition-ally, semantic roles can also be labeled with one of13 ARGM adjunct labels, such as ARGM-LOC orARGM-TMP for additional locational...

Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf

... Lexical Chain Features 4.1 Chain starts and ends We follow (Chan et al. 2007) to model the lexi-cal chain starts and ends at a story boundary with a statistical distribution. We apply a window ... consideration and statistically modeled. 2 Experimental Setup Experiments are conducted using data from the TDT-2 Voice of America Mandarin broadcast. In particular, we only use the data from ... terms and locating instances of time where the count of chain starts and ends (boun-dary strength) achieves local maxima. Chan et al. (2007) enhanced this approach through statistical modeling...

Báo cáo khoa học: "Linear Text Segmentation using a Dynamic Programming Algorithm" potx

... (Heinonen,1998) and Utiyama and Isahara (Utiyama and Isa-hara, 2001).Finally, other researchers use probabilistic ap-proaches to text segmentation including the useof hidden Markov models (Yamron et al.,1999), ... following Halliday and Hasan's theory (Halliday and Hasan, 1976),utilize statistical similarity measures such as word cooccurrence. For example the linear discoursesegmentation algorithm proposed ... Linear Text Segmentation using a Dynamic Programming AlgorithmAthanasios KehagiasDept. of Math., Phys. and Comp. SciencesAristotle Univ of ThessalonikiGREECEkehagias@egnatia.ee.auth.grFragkou...

Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx

... standard name approach was taken by the KAMP system. The standard name assumption has two difficul- ties. First, it is extremely implausible to believe that an agent has a unique name for anything ... This approach to language generation emphasizes the view of language as action, and hence assigns a critical role to prag- matics. The noun phrases under consideration in this paper are those ... As an intermediate step toward this ultimate goal, we shall propose a taxonomy of concept activation actions that convey the various intentions a speaker may have with re- spect to a hearer...

Báo cáo khoa học: "M AX S IM: A Maximum Similarity Metric for Machine Translation Evaluation" doc

... workshop, Kappa values measured forinter- and intra-annotator agreement for rank and constituent are substantially higher than those foradequacy and ﬂuency, indicating that rank and con-stituent are ... uses a large collection of paraphrases, automatically ex-tracted from parallel corpora, to evaluate MT per-formance. To compare a pair of sentences, ParaE-val ﬁrst locates paraphrase matches ... unigram and trigram bipartite graphs, we similarly calculatetheir respective w(M ) and add to the correspondingmatchuni and matchtri.Based on matchuni, matchbi, and matchtri, wecalculate...

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

... pDU-PABP(s) EarI-catgaaccccagtgcc7 pDU-RBDII(s) EarI-catggatgttataaagggc8 pDU-RBDIII(s) EarI-catgggacgatttaagtct9 pDU-RBDIV(s) EarI-catggaacagatgaaacaa10 pDU-PABPC(s) EarI-catggagcgccaggctcac11 pDU-IMP1(s) ... PABP, and surpris-ingly we have found that both polypeptides bindstrongly to a 22 nucleotide long CCCAAAAAAAUUUACAAAAAA sequence located at the 3¢ endof the ARS. Furthermore, CCCAAAAAAAUUU wasfound ... pDU-IMP1(s) EarI-catgaacaagctttacatcg12 pDU-KH1(s) EarI-catggtggacatcccccttcgg13 pDU-KH3(s) EarI-catggctgctccctatagctcc14 PABP(as) KpnI-ttaaacagttggaacaccgg15 RBDI(as) KpnI-ttagcctactccacttttgcg16...

Báo cáo khoa học: Hemagglutinin-33 of type A botulinum neurotoxin complex binds with synaptotagmin II potx

... Madison, WI, USA) were used as primary and secondary antibodies. The absorbance was measured using a microplate reader (GMI, Inc., Albertville, Minne-sota, USA) and softmax software (Molecular ... revealed that one65 kDa band from the 0.1 m NaCl eluate is synapto-tagmin, as indicated by comparison with a positivecontrol of rat brain tissue extract and synaptosomalprotein extract (data ... Similaranalysis of the 0.5 m NaCl eluate revealed four proteinbands with molecular masses of approximately 90, 55,50 and 45 kDa. Western blot analysis using anti-syn-aptotagmin as the primary antibody...

Xem thêm