Beyond the Business Cycle: The Need for a Technology-Based Growth Strategy potx

... includes the impact of capital and other inputs. 34 Nevertheless, because labor productivity is easier to calculate, it is available much faster than MFP and has the added advantage of being ... over the past two decades. The result has been tremendous growth in the competitive capacity of China, India, Korea, and Taiwan. But this rapid growth in Asia has reduced rates...

Ngày tải lên: 08/03/2014, 16:20

... currently available for wind engineering research, advances are being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the building envelope ... respondents to the committee's questionnaire. All of these assessments agreed that large-scale data are needed to improve structural performance and that an LSWTF could...

Ngày tải lên: 08/03/2014, 19:20

... the base-line±univariate, base-line±bivariate and spatial models. At the top right-hand side are summarized the posterior probabilities that the overall eects are larger than 0 for each lag speci®cation. In the ... public health importance than the latter. Corresponding to the hierarchical nature of the data, the analysis also has three stages: (a) the summary of perso...

Ngày tải lên: 06/03/2014, 16:20

... Gardbaum, The New Commonwealth Model of Constitutionalism’ (2001)49 American Journal of Comparative Law 707–60, for a detailed analysis of these features. 3 Jos ´ eMar ´ a Maravall and Adam ... emer- gency. Rather, they are detained because it is alleged that they fall into the category of ‘enemy combatants’, a category which is beyond the reach of both domestic and internation...

Ngày tải lên: 07/03/2014, 02:20

... Picard [37]. In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting ... DNA template to NKA48 for dsRNA synthesis was generated from first-strand cDNA and the following primers (NKA48, accession number DQ017261): 5¢-GATGCATAATACGACTCACTATAGG...

Ngày tải lên: 07/03/2014, 12:20

... RAND Health Final Report on Assessment Instruments for a Prospective Payment System Appendices Joan L. Buchanan, Patricia Andres, Stephen M. Haley, Susan M. Paddock, David C. Young, Alan Zaslavsky Prepared ... Health Care Financing Administration). The research was conducted through a subcontract from RAND to Harvard University and represents a collaborative effort involving facul...

Ngày tải lên: 07/03/2014, 05:20

... apply on the face. This specifically removes the tan and assists in reducing the growth of facial hair. When it is already applied on the face, scrub it off with a good face scrub and then wash ... rashes. For many, these rashes lower their self-esteem, but this is actually not a big problem to think about. There are a lot ways to avoid rashes. Perhaps one of the best...

Ngày tải lên: 08/03/2014, 14:20

... difficult than what they have learnt and studied for the exam, others say that these test items are easy and relevant to what they have been taught. Therefore finding out whether the tests are closely ... example, they have to write many more items than they actually need for a test. After that they have to pre-test and analyze students’ performance on the item evaluate item...

Ngày tải lên: 10/04/2013, 14:46

Ngày tải lên: 08/08/2012, 17:20