... particles, there was a progressive lengthening and thickening of the actin filaments at the cell peripheral The postulation was that the vectorial force of the growing length of the actin filament ... PBS for the duration of each time, after which they were fixed with a 2% paraformaldehyde/0.2% glutaraldehyde solution at pH 7.4 for 30 The fixative solution was decanted and the samples washed ... morphological data By adjusting the probe to engage the sample with greater force, the probe tip physically pushes against the soft sample surface to image sub-surface structures It was through this ability...
Ngày tải lên: 11/08/2014, 00:22
... structural environments: as a part of Gag, as an unassembled protein, and as an independent protein forming the mature capsid Remarkably, the CA polypeptide appears to have evolved an extraordinary ... resembling authentic mature capsids can be also obtained Despite the difference in shape, the cylindrical capsid- like particles are organized with the same hexameric lattice as the cone-shaped, authen- ... for the assembly and stability of the retrovirus capsid, and of viral capsids in general Moreover, the successful rational or semi-rational design of anti-HIV drugs that are able to impair capsid...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGACACTCATACTAACGCCATG ... DSLA1 5’341T7 DHp2s GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo hóa học: " Therapeutic immunisation of rabbits with cottontail rabbit papillomavirus (CRPV) virus-like particles (VLP) induces regression of established papillomas" docx
... antigen The appearance of papillomas was monitored, the papilloma sizes were measured weekly beginning at week seven and the GMDs calculated The mean GMDs and SEM of papillomas were plotted against ... the study and drafted the manuscript EPR provided the VLPs A- LW participated in the coordination of the study All authors read and approved the final manuscript Acknowledgements We thank Dr N ... Journal 2008, 5:45 prophylactic and therapeutic vaccines in various animal models [5,6] Preclinical studies using the cottontail rabbit papillomavirus (CRPV) in rabbits, canine oral papillomavirus...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Molecular and macromolecular alterations of recombinant adenoviral vectors do not resolve changes in hepatic drug metabolism during infection" potx
... GGC CAG GAA ATA CAA GAC AA Sense: CTG CTG CTG CTG AAA CAC GTC Antisense: GGA TGA CAG CGA TAC TAT CAC Sense: GAG CTC TGG GCA GAA ACA TC Antisense: ACA CGG CAG ATT TGA AGA CC Sense: CTC TAC CCA GGT ... beta-galactosidase (HDAd), or inactivated AdlacZ (UVAd) Values are presented as the mean ± standard error of animals/treatment/timepoint Statistical significance was determined between individual ... μg, Sigma) was added as an internal standard The organic phase was evaporated under a constant stream of air, dissolved in 200 μl of methanol and stored in a sealed tube at 4°C until analysis...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Induction of neutralising antibodies by virus-like particles harbouring surface proteins from highly pathogenic H5N1 and H7N1 influenza viruses" pot
... DK and VV provided guidance and analysed the data All authors have read and approved the manuscript 17 18 Acknowledgements We thank Dr P Puthavathana (Mahidol University, Bangkok, Thailand) for ... Puthavathana P, Auewarakul P, Charoenying PC, Sangsiriwut K, Pooruk P, Boonnak K, Khanyok R, Thawachsupa P, Kijphati R, Sawanpanyalert P: Molecular characterization of the complete genome of human ... safe Altogether, there is a strong need for developing novel immunogenic formulations that can rapidly be prepared as vaccines against the emerging highly pathogenic avian influenza virus As a...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " Serum interferon-gamma and interleukins-6 and -8 during infection with Fasciola gigantica in cattle and buffaloes" ppsx
... obtained at 450 nm using an ELISA plate reader and background readings were subtracted from readings of the unknown samples Values obtained were read against the standard curve taking into consideration ... Australian Centre for International Agricultural Research (ACIAR) project AS1/ 96/160 on the Control of Fasciolosis in Cattle and Buffaloes in Indonesia, Cambodia, and the Philippines References Abbas ... Elizabeth C Molina Fig IFN-γ profile in cattle (a) and buffaloes (b) infected with F gigantica and non-infected cattle and buffaloes were determined by ELISA The assay made use of mouse anti-ovine...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps
... protein in rat articular cartilage Calcif Tissue Int 1995, 57:196-200 36 Tsukazaki T, Ohtsuru A, Namba H, Oda J, Motomura K, Osaki M, Kiriyama T, Iwasaki K, Yamashita S: Parathyroid hormonerelated protein ... T, Takashima H, Iwata K, Katamine S, Nagataki S: High seroprevalence of anti-HTLV-I antibody in rheumatoid arthritis Arthritis Rheum 1996, 39:463-466 Motokawa S, Hasunuma T, Tajima K, Krieg AM, ... Kitajima I, Nakajima Y, Osame M: Chronic inflammatory arthropathy associated with HTLV-I Lancet 1989, i:441 Yin W, Hasunuma T, Kobata T, Sumida T, Nishioka K: Synovial hyperplasia in HTLV-I associated...
Ngày tải lên: 09/08/2014, 01:23
In vitro and in vivo targeted delivery of IL-10 interfering RNA by JC virus-like particles pptx
... the HU6-shRNA template Oligonucleotides used for target site #1 (target site sequences are in bold) IL10-RNAi-1-Forward: 5'-GATCCGCTTCCAAACTGGATATAATTCAAGAGAT; IL10-RNAi-1-Reverse: 5'AGCTTAAAAAAGCTTCCAAACTGGATATAATCTC ... 5'AGCTTAAAAAAGCTTCCAAACTGGATATAATCTC TTGAAT'; Oligonucleotides used for target site #2 (target site sequences are in bold); IL-10 RNAi-2-Forward: 5'GATCCGTCTTCTGGAGTTCCGTTTTTCAAGAGA A; IL10-RNAi-2-Reverse: ... 60 s at 60°C and 30 s at 72°C The oligonucleotide primers were as follows: for mouse IL-10, 5'-CACTACCAAAGCCACAAAGCA-3' (forward) and 5'-AGGAGTCGGTTAGCAGTATGTT-3' (reverse) The amount of amplified...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "Stability and assembly in vitro of bacteriophage PP7 virus-like particles" pptx
... decreased as the RNA concentration was lowered Meanwhile, as the RNA-toprotein ratio decreased, the yield of capsids first increased and then diminished again as the RNA concentration fell below that ... over the range of the assay For measurement of the quantity of capsids remaining after heat treatment, soluble protein was applied to a 1% agarose gel in 40 mM Trisacetate, pH 8.0, mM EDTA, and ... heated at 67°C in the presence of DTT the rate of capsid disappearance was far more rapid than the decline of soluble protein What might explain this behavior? Observations of the increased stability...
Ngày tải lên: 11/08/2014, 00:22
Thermal Stability of RNA Phage Virus-Like Particles Displaying Foreign Peptides potx
... …GTCGACAATGGCGACTACAAGGACGACGACGACAAGGGCGACGTGACT… F-13/14 …10 11 12 13 14 15 16 17 … …ValAspAsnGlyAspTyrLysAspAspAspAspLysGlyThrGlyAsp… …GTCGACAATGGCGACTACAAGGACGACGACGACAAGGGAACTGGCGAC… (NNS)10-13/16 ... …GlyThrAspTyrLysAspAspAspAspLysGluAlaThr… …GGTACCGATTATAAAGATGATGATGATAAAGAGGCTACT… Figure PP7 sequences, showing the wild-type, the Kpn I mutant and the Flag peptide insertion Note that the mutations ... …GlyGlyThrIleGlnArgGlyProGlyArgAlaPheValGlyThrGly… …GGCCGTACTATTCAGCGCGGCCCGGGCCGCGCGTTTGTGGGTACCGGC… F-13/16 …10 11 12 13 16 17 18 19 … …ValAspAsnGlyAspTyrLysAspAspAspAspLysGlyAspValThr… …GTCGACAATGGCGACTACAAGGACGACGACGACAAGGGCGACGTGACT…...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Kinetics and isotype profile of antibody responses in rhesus macaques induced following vaccination with HPV 6, 11, 16 and 18 L1-virus-like particles formulated with or without Merck aluminum adjuvant" ppt
... low grade cervical dysplasia [8] HPV types and 11, on the other hand, cause approximately 95% of genital warts (condylomata acuminata or venereal warts) and 25% of low grade cervical dysplasia (CIN1) ... profile was similar between animals vaccinated with the two quadrivalent vaccines (Fig 3) However, data from both the antibody isotyping assays and the cLIA showed that the inclusion of MAA to the ... cervical cancer [1] Nearly a quarter of a million women die from cervical cancer and about half a million are diagnosed with this disease each year [2] Cervical cancer accounts for 12% of all cancers...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Human herpes virus 8 replication during disseminated tuberculosis in a man with human immunodeficiency virus: a case report" pdf
... However, as the search for mycobacteria was initially negative, the diagnosis was expanded to include MCD This was supported by the clinical presentation and the high HHV8 viral load measured in the ... read and approved the final manuscript Additional material Additional file Methods The data provided represent the methods employed in the detection and quantification of HHV-8 viral load in the ... (normal range: 14-50 U/l), alanine aminotransferase 69 U/l (normal range: 12-50 U/l), alkaline phosphatase 350 U/L (normal range: 30-125 U/l), gamma-glutamyltransferase 271 umol/l (normal range:...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "Lassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever" ppt
... or anti-viral therapy available for the prevention or treatment of this disease, and there is no commercially available Lassa fever diagnostic assay The threat posed by LASV is heightened further ... therapeutic and prophylactic reagents, and the capacity for aerosolization Collectively, these factors underscore the need for effective diagnostics, vaccines, and therapies against Lassa fever The ... compliance with the Animal Welfare Act and other Federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the Guide for the Care and...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " Self-assembly of virus-like particles of porcine circovirus type 2 capsid protein expressed from Escherichia coli" pptx
... GTCATCACCATCATCATCAC (6 × His) GGGTCGGACTCAGAAGTCAATCAA-3′) and Smt3R (5′-GGATCC (BamHI) GAGACC (BsaI) TTAAGGTCTC (BsaI) AACCTCCAATCTGTTCGCGGTG-3′) A NcoI restriction site followed by a × His ... SDS-PAGE and stored at 4°C for further assay Cleavage of a SUMO tag from a Cap-tag protein to yield authentic VLPs of Cap A cleavage reaction assay was performed containing × SUMO protease buffer, ... into the solution The quantity of the purified Cap-tag protein was obtained by the Bradford assay (Sigma-Aldrich, USA) using bovine serum albumin as a standard It was analyzed through 15% SDS-PAGE...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " The inhibition of assembly of HIV-1 virus-like particles by 3-O-(3'''',3''''-dimethylsuccinyl) betulinic acid (DSB) is counteracted by Vif and requires its Zinc-binding domain" pdf
... technical assistance The efficient secretarial aid of Cathy Berthet is also gratefully acknowledged References Kanamoto T, Kashiwada Y, Kanbara K, Gotoh K, Yoshimori M, Goto T, Sano K, Nakashima H: ... Autoradiograms were scanned and quantitated by densitometric analysis, using the VersaDoc image analyzer and the Quantity One program (BioRad) Alternatively, protein bands were excised from blots and radioactivity ... Note the occurrence of Vpr dimer (Vprx2; 30 kDa), stained in blue with the phosphatase reaction (m), prestained molecular mass markers; (kDa), kiloDaltons membrane localization and encapsidation...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx
... Perelson AS: Estimation of early hepatitis C viral clearance in patients receiving daily interferon and ribavirin therapy using a mathematical model Hepatology 2001, 33(2):419-423 Tsubota A, Arase ... probably mediated by immune clearance of infected hepatocytes, appears as the strongest viral kinetic predictor of early viral clearance Mathematical modelling of viral dynamics revealed that ... virological response The early identification of patients with no SVR may lead for proposing an interruption of therapy for avoiding side effects and additional costs, or an early change of therapy...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo sinh học: "The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression" docx
... TCGCGTATGTCTCAAGTTGAGAG, Probe: FAM-ATCAACTTCAATGAAAAA-MGBNFQ Mouse 18S RNA Forward TAACGAACGAGACTCTGGCAT, primer 5' Reverse primer 5' CGGACATCTAAGGGCATCACAG Probe 5' TAMRA FAM-TGGCTGAACGCCACTTGTCCCTCTAA- ... contaminating DNA RT-PCR was then performed in the presence of the forward primer RBF2 (5' AGATCCACAAGCTCCTGA) and reverse primer RBR1 (5' ATAAGCTGCAATAAACAAGT) to amplify RB15 RNA At the same time, PCR ... particles) was separated on 10% SDS polyacrylamide gel under standard conditions and AAV2 capsid proteins (VP 1, VP2 , and VP3 ) were detected using monoclonal antibody against AAV2 capsid proteins (American...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... Gag and Pol and were under the control of the CMVp Basically, they lacked the untranslated 5'LTR-gag region that, together with the initial part of gag, form the ψ signal required for viral RNA ... gene therapy a good therapeutic approach for HIV-positive patients? Genet Vaccines Ther 2007, 5:5 Palucka AK, Laupeze B, Aspord C, Saito H, Jego G, Fay J, Paczesny S, Pascual V, Banchereau J: ... start a cascade of events ultimately leading to immune responses against the invading antigens Thus, at least theoretically, safe and effective systems for delivering antigenic and/or adjuvant...
Ngày tải lên: 14/08/2014, 19:22