Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Báo cáo khoa học: Inhibition of the mitochondrial calcium uniporter by the oxo-bridged dinuclear ruthenium amine complex (Ru360) prevents from irreversible injury in postischemic rat heart docx

Báo cáo khoa học: Inhibition of the mitochondrial calcium uniporter by the oxo-bridged dinuclear ruthenium amine complex (Ru360) prevents from irreversible injury in postischemic rat heart docx

... [Ca 2+ ] m in isolated hearts was to measure the activated pyruvate dehydrogenase (PDH) activity in heart homogenates at the end of the perfusion protocols. PDH is activated by a calcium-dependent phosphatase. ... mitochondria obtained from untreated hearts; (m) values from mitochondria obtained from hearts treated with Ru 360 . Each value was obtained from a single heart and...

Ngày tải lên: 16/03/2014, 22:20

12 428 0
Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

... 1E and F). These data indicate that elevation of intracellular cAMP and subsequent activation of PKA lead to the inhibition of NF-jB activity. To further examine the effect of PKA on NF-jB activity, we ... Inhibition of the NF-jB transcriptional activity by protein kinase A Naoko Takahashi, Toshifumi Tetsuka, Hiroaki Uranishi and Takashi Okamoto Depar...

Ngày tải lên: 08/03/2014, 10:20

7 296 0
Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

... cassette was con- firmed by PCR. dLtA-P1, 5¢-ACAAATATAGACACCGAGCAAAATGG CAA; dLtA-P2, 5¢- CGAGCTCGAATTCGTAATCATGGT CATATTATAAATATATGAACCGCTATTCGCGGT-3¢ (3¢ kanamycin fragment underlined); dLtA-P3, ... no A- domain with a d-aa as the sole substrate has been biochemically characterized. Especially the fact that the enzyme does not activate l-Ala corroborates the finding that A- doma...

Ngày tải lên: 30/03/2014, 16:20

11 407 0
Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

... using the Protein Assay kit based on the method of Bradford [44]. Standards and sam- ples were assayed in triplicate, according to the manufac- turer’s instructions. Sample absorbances were read against a ... and the variable substrates. Plausible rationalization includes the possibility that the relatively small nitro- benzothiadiazole may displace the dimethylbenzimidaz-...

Ngày tải lên: 19/02/2014, 05:20

13 424 0
Tài liệu Báo cáo khoa học: Regulation of the actin–myosin interaction by titin doc

Tài liệu Báo cáo khoa học: Regulation of the actin–myosin interaction by titin doc

... actin-activated myosin ATPase activity in the same way as T800 [64,69]. Inhibition of the ATPase activity was then explained by a slowing down of the formation of active complex in solution. On the other ... we measured the Mg 2+ -ATPase activity of HMM and various actin–HMM complexes in the presence or absence of T800. The ATPase activity of HMM alone...

Ngày tải lên: 19/02/2014, 16:20

10 516 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... sing H 2 O 2 . The role of radical vs. nonradical processes has been investigated, as has the prevention of such damage. MATERIALS AND METHODS Amino acids, peptides and antioxidants were commercial samples ... can also arise via radical Table 2. Percentage of enzyme activity retained after incubation of GAPDH, GR and LDH with N-Ac-Trp-OMe peroxides or H 2 O 2 at 37 °Cinthe absen...

Ngày tải lên: 21/02/2014, 03:20

10 462 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... 3-OH-c-car- otene and lycopene. The values represent ratios of the C 17 and C 19 dialdehydes in the sum of their peak areas calculated by integrating each peak at its individual k max . Data represent ... citral, the mixture of geranial and its cis-isomer neral, is a major component of the aroma of lemon grass and other lemon-scented plants. Geranial is synthesized fro...

Ngày tải lên: 07/03/2014, 03:20

12 498 0
Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

... FEBS starch digestion. SIM accounts for almost all sucrase activity, all isomaltase activity, and 80% of the maltase activity, while MGA accounts for all glucoamylase activity, 20% of the maltase activity, ... four-carbon chain of salacinol and the seven-carbon chain of kotalanol. Fig. 2. Schematic diagram of MGA protein organization and expression construct. Amino acid...

Ngày tải lên: 07/03/2014, 12:20

11 527 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

... presence of curcumin, using the coupled enzyme assay. In Fig. 3A, the half-maximal activation of the ATPase by Ca 2þ was measured in the absence of and in the presence of 10 and 25 m M curcumin. The ... of Ca 2þ (Fig. 4A) . The data showed that the amount of ATP bound to the ATPase was reduced by curcumin. The binding inhibition had a apparent K i (IC 5...

Ngày tải lên: 08/03/2014, 23:20

10 594 0
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx

Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx

... calcium-dependent phosphorylation at some of the pinpointed residues in the cytosolic region of KAT1. Abbreviations AAPK ⁄ ABR kinase, ABA-activated protein kinase ⁄ ABA-responsive kinase; ABA, ... phosphorylation assay, the Vicia AAPK ⁄ ABR kinase has been shown to phos- phorylate the C-terminal region of KAT1 [16]. One of the 10 members of the SNF1-related pro...

Ngày tải lên: 22/03/2014, 21:21

11 531 0
Từ khóa:
w