Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... a ˜ o et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required ... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region...
Ngày tải lên: 08/03/2014, 10:20
... GGTGATATAGGCTTGACTCCGTTGA LdUSP-RR1 GGCATCTGTTTCTTTGTCGCTTGTC LdEcR-RR2 ACACACTCTGCCCTCATTCCTACGG LdUSP-RR2 CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 ... body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis T...
Ngày tải lên: 07/03/2014, 21:20
... doi:10.1046/j.1432-1033.2003.03878.x reaction (RT-PCR) and RACE-PCR. Marathon-Ready TM human adrenal gland and fetal brain cDNA libraries were purchased from Clontech (Palo Alto, CA, USA). The RACE-PCR was performed according to the ... shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio, and the sample size per cRNA combination is shown in parenthesis....
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot
... stomach total RNA sam- ples of three animals in the unrelated dsRNA treated group. The arrow denotes the size of the signal obtained only in stomach total RNA pool from the control animals. A B Fig. ... Phar- macia) according to the instructions of the manufacturer. Northern blot analysis Northern blot analysis was used to characterize the expres- sion of the...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: Molecular cloning of the ecdysone receptor and the retinoid X receptor from the scorpion Liocheles australasiae pot
... GCATTCCGACACTGAGGCACTTTT RR2 AGCCTTTACAACCTTCACAGC Primers for 3¢-RACE RF1 GAAAAAGTGCCTCAGTGTCGGAATG RF1 ATAGCTGTGAAGGTTGTAAAGG RF2 CAGTGTGCCATCAAACGGGAGTCTA RF2 GACAAACGTCAAAGGAATCG a N means a mixture of ... CATCATNACYTCNSWNSWNSWNGC R2 CAYTTYTGRTANCKRCARTA R3 AAYTCNACDATNARYTGNACNGT R3 GCAAGCTGGAAAAGAGTAATGTGAC Priners for 5¢-RACE RR1 AGACTCCCGTTTGATGGCACACTG RR1 ATACTGGCAGCGATTCC...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... mammals and can acts on the a- andb-sites of the mammalian sodium channel [44]. Therefore, whether Tyr31 is related Table 2. The amounts of aconitine required to induce arrhythmia in untreated rats ... bp, respectively. A single AATAAA polyadenylation signal was found 11 nt upstream of the poly (A) tail. There was only one stop codon (TAA) at the 3¢ terminus of the OR...
Ngày tải lên: 31/03/2014, 09:20
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... with a Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse ... reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, respectively. Primers for quantification of actin mRNA w...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene (GenBank accession numbers BE590673 and ... purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) oligo- nucleotide primers having...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... isomerase activity of PDI [23]. The lag time before appearance of the active RNase A indicates the oxidase activity, which corresponds to the x-intercept of the RNase activity plot. The oxidase activity matches ... reaction times, the refolding mixture was acidified and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated fr...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... 5¢-GTCTGTGGTACCTCCTTCAAAA CCCCCTCCT-3¢ and 5¢-CGTGATGGTACCGGGTGTG CAACCCACATGTA-3¢ for GmPDIL-1, and 5¢-CAGCCC GCAGTTGAAAGTCAACCAAGTC-3¢ and Oligo dT- Adaptor primer FB (TaKaRa Bio Inc.) for GmPDIL-2. Amplicons ... amplified from cDNAs of GmPDIL-1 and GmPDIL-2 by PCR using the oligonucleotide primers 5¢-GACGACGACAAGATGGAG GAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGA AGCCCGGTTCAAAGCTCATCTT...
Ngày tải lên: 07/03/2014, 05:20