Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse ... opti- mized metal–ligand distances (Table 2) compare very favorably with data in the protein database, from which an average distance of 2.03 A ˚ for Fe–N(His) was inferred [38...
Ngày tải lên : 18/02/2014, 06:20
  • 15
  • 624
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam)...
Ngày tải lên : 19/02/2014, 12:20
  • 10
  • 500
  • 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... CGGGGATCCGCATCGGAACAAAACAATAC BamHI rFnBPB 37–480 R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaI rFnBPB 163–463 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–463 R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG ... SmaI rFnBPB 163–308 F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHI rFnBPB 163–308 R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaI rFnBPB 309–480 F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHI rFnBPB 309–480 R AAT...
Ngày tải lên : 06/03/2014, 00:20
  • 13
  • 514
  • 0
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

... 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacct attggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtac cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and ... tgttactagcactcac atgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcct ccagagctctagaag-3¢, i...
Ngày tải lên : 07/03/2014, 11:20
  • 7
  • 514
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...
Ngày tải lên : 15/02/2014, 01:20
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... compilation ª 2011 FEBS Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein Kentaro Takahama 1, *, Katsuhito Kino 2, *, Shigeki Arai 3 , Riki...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... view from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was d...
Ngày tải lên : 16/02/2014, 09:20
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... -ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ATG GTG ATG ATG GTG TGG GGT CAG CGG TGC AGC AGG GGG GGT-3¢ (XbaI sites underlined; His-tag in italic) ... phospholipids and that this is fol- lowed by an interaction between the apolar acyl chains of the phospholipids and side chains of particular amino acids, thus accounting for the increased cap...
Ngày tải lên : 18/02/2014, 11:20
  • 11
  • 562
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... h D 1 h Autoradiography Add D beads and incubate D A O 2 Read AlphaLISA si g nal at 615 nm HSE Fig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DN...
Ngày tải lên : 18/02/2014, 14:20
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... and ammonia. They belong to a superfamily [1] that includes amidases, acyl transferases and N-carbamoyl- d-amino acid amidohydrolases, and they occur in both prokaryotes and eukaryotes. Their applications ... the bar indicates the fraction assayed. (B) Reducing SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of  40 kDa. The contaminating band at 60 kDa wa...
Ngày tải lên : 19/02/2014, 00:20
  • 10
  • 450
  • 0

Xem thêm