Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... Linguistics Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates Paula Carvalho Luís Sarmento University of Lisbon Labs Sapo UP & University of Porto Faculty of ... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009)....

Ngày tải lên: 20/02/2014, 05:20

... with hydrophobic character: Pro51, Val53, Leu69, Leu156 and Ala158. Whereas four arginines (Arg19, Arg71, Arg154 and Arg157), two histidines (His73 and His159), two aspartates (Asp50 and Asp74) and Glu68 form ... precession images generated with the program pattern [32]. The X-ray data were evaluated and scaled with the programs denzo and scalepack [31]. Statistics of the data...

Ngày tải lên: 07/03/2014, 11:20

... we added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢). Amplification was performed ... counterparts. Oxidative and metal bridge polymerization After chromatographic purification and enzymatic removal of the glutathione S-transferase (GST) tail, proteins were analy...

Ngày tải lên: 19/02/2014, 07:20

... (1959) and numerous analyses that have since corrobo- rated his analysis, we assume that the relative pronoun plays a double syntactic role: • On one hand, it has a pronominal role in the relative ... grammar, the parameters to instantiate are the vocabulary V, the set of (lexical) cate- gories C, the set of syntactic relations R, the set of box names B, the set of field names...

Ngày tải lên: 20/02/2014, 18:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Ada...

Ngày tải lên: 18/02/2014, 17:20

... complex than in T cells, with several peaks of nuclease hyper- sensitivity [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ... typically recruit HATs such as SAGA and NuA3, which mainly acety- late histone H3, and NuA4 which acetylates histone H4 on K5, K8 and K12. This cascade of events leads to rec...

Ngày tải lên: 14/02/2014, 18:20

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a ... cycle Cell survival miR-278 Site1: Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCU site2: Expanded UTR 5´ AGAUGGUAAAAUACACGAG CC...

Ngày tải lên: 14/02/2014, 19:20

... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are ava...

Ngày tải lên: 14/02/2014, 22:20

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...

Ngày tải lên: 15/02/2014, 01:20

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... filter paper assay and tritium-labeled substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k cat was calculated using M w (HPRT) = 27132 Da...

Ngày tải lên: 15/02/2014, 01:20