Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx

Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx

Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx

... analysis of a prokaryotic [5] and an eukaryotic [17] cyt b 6 f complex: both in the case of the cyanobacterial complex (Masti- gocladus laminosus) and the green algal complex (Chlamydomonas reinhardtii) ... FEBS Functional implications of pigments bound to a cyanobacterial cytochrome b 6 f complex Stephan-Olav Wenk 1 , Dirk Schneider 1,5 , Ute Boronowsky 1 ,...

Ngày tải lên: 07/03/2014, 16:20

11 520 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

... furiosus and its application in a process of batch starch degradation to alpha-D-glucose-1-phosphate. J Ind Microbiol Biotech- nol 35, 219–223. 38 Nahalka J, Vikartovska A & Hrabarova E (2008) A crosslinked ... MINIREVIEW Biological role of bacterial inclusion bodies: a model for amyloid aggregation Elena Garcı ´ a- Fruito ´ s 1–3, *, Raimon Sabate 1,4, *, Natalia S. de Gro...

Ngày tải lên: 06/03/2014, 00:20

9 432 0
Báo cáo khoa học: "The Contribution of Stylistic Information to Content-based Mobile Spam Filtering" potx

Báo cáo khoa học: "The Contribution of Stylistic Information to Content-based Mobile Spam Filtering" potx

... Korea {danny,jtlee,rim}@nlp.korea.ac.kr Abstract Content-based approaches to detecting mobile spam to date have focused mainly on analyzing the topical aspect of a SMS message (what it is about) but not on the stylistic aspect (how ... and Wal- lace, 1964), and part -of- speech tags and tag n- grams (Argamon-Engelson et al., 1998; Koppel et al., 2003; Santini, 2004). Our experimental...

Ngày tải lên: 31/03/2014, 00:20

4 382 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate. Kinetic characterization of Fe 2+ Bxe _A2 876 The activity of Bxe _A2 876 ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DL...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... Q81N- fwd:5¢-TGGGCCATGCCCTTT AACAGTTATGTCACG CTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACT GTTAAA GGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. ... R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢...

Ngày tải lên: 19/02/2014, 02:20

10 504 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... 5¢-AAGC TTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and 5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAA AGTC-3¢ ... 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG TTTACAAG...

Ngày tải lên: 19/02/2014, 16:20

11 630 0
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx

Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx

... Montes R, Paramo JA, Angles-Cano E & Rocha E (1996) Development and clinical application of a new ELISA assay to determine plasmin-alpha2-antiplasmin complexes in plasma. Br J Haematol 92, 979–985. 60 ... HRP-conjugated CPL-15 at 250 ngÆmL )1 as indicated above. Statistical analysis Statistical analysis was performed using statview 5.0 soft- ware. Results are expressed as means ± SD...

Ngày tải lên: 20/02/2014, 01:20

14 558 0
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx

Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx

... 2847 Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance Barbara Sigala and Irina R. Tsaneva Department of Biochemistry ... intermediate is therefore crucial for the integrity and maintenance of DNA in all organisms including mitochondrial DNA (mtDNA). Mitochondrial DNA amounts to about 15% of the D...

Ngày tải lên: 20/02/2014, 11:20

11 575 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... was inserted as alinker (Figs 1 and 2). Chromosomal DNA from E. coli strain UY211 (ara, D(lac-pro), nalA, thi) [32] was isolated and used as a template in two separate PCR reactions to prepare ... ensure a satisfactory frequency of homologous recombination for the gene replacement. The upstream fragment was prepared using forward primer tsf- UPS (5¢-ATGCG GGATCCAAGCTTGAGCTTACATC AGTAA...

Ngày tải lên: 21/02/2014, 00:20

12 502 0
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

... 5¢-end and 3¢-end of acs: delacs P1 (forward), 5¢-GAGAACAAAAGCATGAGCCAAATTCA CAAACACACCA TTGTG TAGGC TGGAGCT GCTTC G-3¢; and delacs P2 (reverse), 5¢-GGCAATTGTGGGTTAC GATGGCATCGCGATAGCCTGCTTCATATGAATATC CTCCTTA-3¢. ... Pathways of acetate activation and production in E. coli. Acs catalyzes an irreversible pathway for high-affinity acetate activation, and AckA and Pta catalyze a reversible...

Ngày tải lên: 06/03/2014, 11:20

10 507 0
w