Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

... ﬁbroblasts and human carci-noma tissues of the uterine cervix, breast and urinary bladder is shown. NANOGP8 was expressed in all of the human cancer tis-sues that were tested. NANOGP8 was not expressed ... resulted in only one amino acid change in the predicted protein sequence from (Gln, 757CAG) in Nanog and (His, 757CAC) in NANOGP8. Since NANOGP8 has an intact open-reading fragment, so ithas the ... OS732 and Nanog or NANOGP8 in MCF-7 and HepG2 using anti-Nanog antibody. Thelack of expression of both Nanog and NANOGP8 in human ﬁbro-blasts is also shown. Actin (43 kDa) was used as loading control.J....

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... Isolation, sequencingand mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitriﬁcans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & ... is the His residue that in NirS is the proximal axial ligand to the d1heme.Replacement of an equivalent His, His41, in NirF byAla abolished binding of the heme to the protein.Known distal ... used in this study are shown in Table S1.Construction of bacterial strainsInitially, an unmarked deletion was generated in nirF in a wild-type GB17 P. pantotrophus strain. This was performedin...

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (AAC71532) and with the putative triacylglycerol lipaseAAB96044 from Mycoplasma pneumoniae (Mp). Identical aminoacids are indicated by an asterisk and similar amino acids are indi-cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar hydrolases ... (systematic name:Yor084wp) was extractable by low salt and identiﬁedtogether with the peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass ofapproximately 45 kDa (Fig....

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present in the plasmid in ... 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, respectively. YEp351-SUT2was linearized ... plasmidpUG6 [12] was ampliﬁed by polymerase chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and disRAS2revCorrespondence...

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in ... target genes. The data were deposited in GEOdatabase GSE2043 (a complete list of these genesappears in Table S1 and a partial list is shown in Table 1). Because only a single microarray was ... 110, 151–164.26 Tomari S, Nagahama H, Shu Y, Hoshi S, NakayamaK, Nakayama KI & Nagata M (2002) Glomerular dif-ferentiation in p27 and p57 double-mutant metanephroi.Anat Embryol 206, 31–36.27...

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGTGAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGTAGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAAGCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢;and ... site-speciﬁcmutagenesis – distal effects on dimer stabilityMoumita Samanta1, Mousumi Banerjee1, Mathur R. N. Murthy1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian ... 5¢-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢;and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTTGG TGAATCTT-3¢.Protein expression and puriﬁcationThe TIM gene carrying the mutation was expressed in E. coli AA200 (a null mutant for the inherent...

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance oflong actin cables [12]. Consistent with this ... proteins and interacts withskeletal a- actin in the cytoplasm. However, little is known about the mechanism whereby hhLIM interactswith skeletal a- actin and regulates the organizationand rearrangement ... believedto interact with actin ﬁlaments in an indirect mannerthrough the intermediation of actin-binding proteinpartners such as a- actinin or zyxin [10]. However, in agreement with our data on hhLIM,...

Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

... in amylin aggregation, inhibiting amylin aggregation in healthy individuals, but promoting aggregation duringT2D pathogenesis. In summary, amylin–insulin inter-actions are most likely to play a complex ... concentrations ofinsulin. Taking amylin alone as a reference, after incu-bation for 6 h (Fig. 3A) , approximately half ofthe ﬁbril formation was inhibited when amylin wasincubated with insulin.Insulin ... that the peak at 30 mincontained insulin hexamers, and the peak at 40 mincontained insulin monomers and dimers. In anotherFig. 3. Both inhibitory and promotionaleffects on amylin aggregation...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Miyamoto K, Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloningand sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. ... standard.Standard enzyme assaySPRK activity was routinely measured using Suc-Ala-Ala-Pro-Phe-pNA (Sigma Aldrich) as substrate. The peptidaseassay was carried out in a total volume of 250 lL, contain-ing ... containing 1 ngof genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream primer (NP7: 5¢-CAATCTCCATGGCTAGTAGCTTGCACTCAG-3¢)...

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... proctolin (Arg-Tyr-Leu-Pro-Thr) have beencompared to those of enkephalins. Indeed, a dipeptidylaminopeptidase activity appears as one major proctolin-degrading peptidase, liberating the N-terminal ... degradation studies using proctolin (40 lM)as the substrate. SDS/PAGE analysis of fractions contain-ing partially puriﬁed DPP activitiy revealed two majorbands in the range of 82 and 86 kDa ... higher probability than thatcalculated for mammalian DPP III corroborates ourresults that argue for a membrane DPP III in insectswhen it is mainly identiﬁed as a cytosolic peptidase in mammals....

Xem thêm