Camilla: A Tale of a Violin Being the Artist Life of Camilla Urso pdf
Camilla: A Tale of a Violin Being the Artist Life of Camilla Urso pdf
... technical CHAPTER IV. 19 A Tale of a Violin, by Charles Barnard Project Gutenberg's Camilla: A Tale of a Violin, by Charles Barnard This eBook is for the use of anyone anywhere at no cost and ... grand families came in. One of these was to the residence of Madam Armengo and another was the residence of Napoleon then known as the Prince President. At M...
Ngày tải lên: 07/03/2014, 01:20
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf
... conversations average nearly 1,500 a day, or considerably over a quarter of a million a year. On Sundays the trunk telephones are available, but use is made of them only to a small extent, there being ... credit of first suggesting the mail coach was made by a Mr. Palmer, who was then the manager of the theatre in their neighbouring city of Bath. This was a...
Ngày tải lên: 17/02/2014, 02:20
A STUDY ON THE VIETNAMESE ENGLISH TRANSLATION OF EXHIBIT LABELS IN THE VIETNAM MUSEUM OF ETHNOGRAPHY
... translation should possess the style of the original 7 7. A translation should read as a contemporary of the original 8. A translation should read as a contemporary of the translation 9. A translation ... cabinet for candidates taking the Mandarin examinations The translation of the concept ‘tủ sách c a thầy đồ’ is really clear and easy to understand. ‘Candi...
Ngày tải lên: 07/09/2013, 13:06
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx
... constant calcula- ted directly from the change in absorbance of MAO -A after addition of guanabenz fitted to a rectangular hyperbola was 20.3 ± 1.3 lm. The mean K D value for guanabenz and the values for ... 1). Interestingly, the result of docking a positively charged (protonated) guanabenz was the same as for the un- charged molecule. At the pH of the assay and p...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... Watanabe, T., Kobori, K., Miyashita, K., Fujii, T., Sakai, H., Uchida, M. & Tanaka, H. (1993) Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of Bacillus circulans ... residues are proposed on the basis of the observed mutational effects, the pH-dependency of these effects, pK a calculations and available structural informa- tion. The results indi...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table 1 and remain invariable all the rest of parameters. The obtained results are ... the stationary operation of a two-mode random microlaser we have found the transformation of saturated values of mode intensity when laser parameters as gain and loss co...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... highly detyrosinated [8,9] and, further, contain a low although significant amount of D2tubulin, an isospecies lacking also the ultimate glutamic acid residue and that cannot be retyrosinated by the ligase ... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody. Capabili...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... site of RgDAAO. A superimposition of the active sites of yeast and mammalian DAAO [2–4] shows that the side chain of Y223 of RgDAAO overlaps with the position occupied by Y228 in pkDAAO (the residue ... 1A) . R285 has been mutated to lysine, glutamine, aspartate, and alanine [10]. The perturbation of the active site in the R285 mutants modifies the precise substrat...
Ngày tải lên: 17/03/2014, 17:20
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... have a direct impact on talent, and there are notable ties between what participants had to say about the role of internal audit and the changes they expect to see in organizational approaches ... States, the internationalization of accounting standards may lead to a change in the language of accounting. The growth of outsourcing and an upsurge in the offshoring o...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. ... Gambeta. We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and digested t...
Ngày tải lên: 23/03/2014, 04:21