Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRB FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRA FnBPA-1 FnBPA-2 FnBPA-3 FnBPA-4 FnBPA-5 FnBPA-6 FnBPA-7 FnBPA-8 FnBPA-9 FnBPA-10 FnBPA-11 GST FnBRA A < /b> 490 ... - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 G...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... CAGCAGGATCCTCTAGAGAGTTTAGTCTT TG-3¢)anda5¢-terminus primer (one of < /b> 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ ... ¢-AAG CTTCACCATGGAGCGGATCCCCAGCGCGCAACC AC-3¢)anda3¢-terminus primer (one of < /b> 5 ¢-TCTA GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA TGG-3¢,5¢-TCTAGACTACCCACTCGAGTGAGCGA AAGTCCG...

Ngày tải lên: 19/02/2014, 16:20

11 630 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A,< /b> T, G, C) and < /b> pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and < /b> pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and < /b> downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAA...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo khoa học: Functional analysis of mutations in UDP-galactose-4epimerase (GALE) associated with galactosemia in Korean patients using mammalian GALE-null cells pdf

Báo cáo khoa học: Functional analysis of mutations in UDP-galactose-4epimerase (GALE) associated with galactosemia in Korean patients using mammalian GALE-null cells pdf

... UDP-galactose as sub- strate. Enzyme activity was normalized against < /b> the < /b> relative protein < /b> abundance calculated from the < /b> intensities of < /b> myc–GALE and < /b> tubulin bands in the < /b> western blot. A < /b> representative ... supernatant was resolved by SDS ⁄ PAGE and < /b> myc–GALE and < /b> EGFP pro- teins were detected by western analysis < /b> using...

Ngày tải lên: 07/03/2014, 00:20

10 513 0
Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

... act as catalytic base [9]. However, the < /b> active site of < /b> homoserine kinase has no residues capable of < /b> acting as a < /b> catalytic base [7] and < /b> catalysis is believed to be driven through the < /b> stabilization ... of < /b> the < /b> metabolic control of < /b> flux through the < /b> Leloir pathway. Analysis < /b> of < /b> the < /b> galactokinase, its mutants,...

Ngày tải lên: 08/03/2014, 02:20

8 414 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... The < /b> absence of < /b> additional bands in the < /b> western blot indicates that at least in COS-7 cells only the < /b> first start codon (Table 1) is used. As the < /b> Hu-K4 mRNA is most abundant in brain and < /b> since the < /b> ... the < /b> membranes of < /b> intracellular organelles although they lack a < /b> transmembrane domain. They are attached to the < /b> cytoplas...

Ngày tải lên: 19/02/2014, 17:20

9 518 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and < /b> use of < /b> N-acylsulfonamides and < /b> sulfonimides as antagonists of < /b> nucleic acid-binding proteins. Database Structural data for the < /b> two RNase A < /b> complexes are available in the < /b> Protein < /b> Data Bank ... began by determining the < /b> ability of < /b> three backbone analogs of < /b> RNA to inhibit catalysis by RNase A.< /b> These...

Ngày tải lên: 14/02/2014, 22:20

9 627 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... cellular model of < /b> Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and < /b> ... 4. Activation of < /b> the < /b> NF-jB pathway. (A)< /b> NF-jB activity mea- sured by luciferase gene reporter assay after 24 h dopamine treat- ment (DA) relative to b- gal...

Ngày tải lên: 15/02/2014, 01:20

11 776 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a < /b> PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and < /b> GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the < /b> forward and < /b> reverse oligonucleotide primers, respectively. The < /b> primers were designed ... dissolved O 2 . HPLC analysis < /b> of < /b> the < /b> products of < /b> the < /b> enzymatic transformation revealed that Bxe _A2< /b> 876 catalyzed bre...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... fraction of < /b> the < /b> total amount of < /b> PAI-1 forming a < /b> stable complex with uPA, was calculated from the < /b> amount of < /b> PAI-1 required to inhibit half the < /b> uPA. The < /b> half-life of < /b> PAI-1 was finally calculated from ... percentage of < /b> the < /b> theoretical maximum. The < /b> activity was monitored over time and < /b> the < /b> rate...

Ngày tải lên: 20/02/2014, 11:20

9 606 0
w