A review of non-financial incentives for health worker retention in east and southern Africa pot
A review of non-financial incentives for health worker retention in east and southern Africa pot
... Lesotho, Madagascar, Malawi, Mauritius, Namibia, Mozambique, South Africa, Swaziland, Tanzania, Uganda, Zambia and Zimbabwe. EQUINET DISCUSSION PAPER NO . 44 3 A review of non-financial incentives for ... (29.6% of all health workers in PHC facilities, and 70.4% in the hospitals); A review of non-financial incentives for health worker retention in...
Ngày tải lên: 06/03/2014, 19:20
Promoting Adolescent Sexual and Reproductive Health in East and Southern Africa pptx
... in school populations in Sub-Saharan Africa (Kaaya et al., 2002b) and adolescent and youth sexual behaviour in South Africa (Eaton et al., 2003). e second domain in which data are necessary ... www.hsrcpress.ac.za Promoting Adolescent Sexual and Reproductive Health in East and Southern Africa Edited by Knut-Inge Klepp, Alan J. Flisher and Sylvia F. Kaaya N...
Ngày tải lên: 07/03/2014, 09:20
Promoting Adolescent Sexual and Reproductive Health in East and Southern Africa doc
... in school populations in Sub-Saharan Africa (Kaaya et al., 2002b) and adolescent and youth sexual behaviour in South Africa (Eaton et al., 2003). e second domain in which data are necessary ... www.hsrcpress.ac.za Promoting Adolescent Sexual and Reproductive Health in East and Southern Africa Edited by Knut-Inge Klepp, Alan J. Flisher and Sylvia F. Kaaya N...
Ngày tải lên: 22/03/2014, 18:20
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx
... refined flour, • low in total fat, but containing necessary essential fatty acids, • no red meat, • a balanced ratio of omega 3 and omega 6 fats and would include DHA, • flax seed as a source of ... Schuurman AG, Goldbohm RA, Brants HA, van den Brandt PA: A prospective cohort study on intake of retinol, vitamins C and E, and carotenoids and prostate cancer risk (Nether...
Ngày tải lên: 06/03/2014, 02:21
A Review of Qigong Therapy for Cancer Treatment pptx
... measured the skin temperature before and during Qigong practice, and found that there’s an increase in back part of facial tem- perature and more infrared radiation from the palm. An- other study ... verify their findings). Qigong therapy for cancer is an area that is often neglected by mainstream medicine and research, and it should be seriously examined and considered...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx
... 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc tagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcct ccagagctctagaag-3¢, into the ... containing several restriction sites, 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacct attggtcttactgacatccactttgcctttctctccacag...
Ngày tải lên: 07/03/2014, 11:20
Natural remedies for poultry diseases common in ‘natural’ and ‘organic’ flocks potx
... each day. Natural remedies for poultry diseases common in ‘natural’ and ‘organic’ flocks Jacquie Jacob and Tony Pescatore 3. You should have in place a reaction plan in the case of a health ... be administered in the ab- sence of illness. Probiotics are a potential tool for reducing in- testinal contamination with disease-causing and foodborne bacteria....
Ngày tải lên: 08/03/2014, 09:20
Agricultural Marketing Companies as Sources of Smallholder Credit in Eastern and Southern africa docx
... sustainability of contract farming and input credit schemes is linked to the problems of law enforcement in contract farming in East and Southern Africa and the obvious lack of an appropriate ... Sources of Smallholder Credit in Eastern and Southern Africa aims to enhance IFAD’s understanding of a range of issues relative to these two strategic areas,...
Ngày tải lên: 22/03/2014, 20:20
Toward Incentives for Military Transformation - A Review of Economic Models of Compensation doc
... Military rank determines basic pay and basic allowances for housing. The largest share of regular military compensation is basic pay. 5 The services share the same basic pay table for officers, ... than the usual level of effort. Thus, an organization must ensure that enough positions are vacated in each grade of the organization each particular year. In private-sector organi...
Ngày tải lên: 23/03/2014, 02:20
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... Yasuda, H., Nakazawa, T., Taniguchi, M. and Akiyama, K. (2009) Indoor Mite and Insect Allergens and Allergic Disease. Indoor Environ., 12, 87–96 (in Japanese). 67) WorldHealth Organization, Air ... 2068–2076. 114 )Kamijima, M., Sakai, K., Shibata, E., Yamada, T., Itohara,S.,Ohno, H., Hayakawa, R., Sugiura, M., Yamaki, K. and Takeuchi, Y. (2002) 2-Ethyl- 1-hexanol in indoor air as...
Ngày tải lên: 17/02/2014, 22:20