MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf

MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf

MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf

... MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT Gülbin ŞAHİNBEYOĞLU RESEARCH DEPARTMENT Discussion Paper No: 2001/1 ANKARA January, ... exchange rate and interest rate which are available at a high frequency and set in their anticipation of future inflation. In the framework of the model, inflationary ex...

Ngày tải lên: 06/03/2014, 14:20

41 271 0
A visit from a pen pal

A visit from a pen pal

... Their yard is separated from the factory by a tall fence. (Sân nhà họ được ngăn cách với nhà máy bằng một hàng rào cao.) -» separate (adj): riêng biệt; khác nhau —» separation (n): sự chia tách; ... www.videobook.vn UNIT 1: A VISIT FROM A PEN PAL (Chuyến viếng thăm c a một người bạn qua thư) 1. Vocabulary pen pal (n): bạn qua thư (ch a gặp mặt) to correspond (v) (with s...

Ngày tải lên: 17/01/2013, 09:58

5 1,7K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... students will be able to use past simple, and past simple with wish II. Language contents: 1. Grammar : 2. Vocabulary : III. Techniques : Eliciting questions, asks and answers IV. Teaching aids : Textbook, ... ask and answer questions about what Ba, Nga, Lan, Nam and Hoa did on the weekend ( exercis1/ P 11) +Tell them that the activities happened in definite in the past. + Let students p...

Ngày tải lên: 21/06/2013, 01:27

2 1,1K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... Remember + Call some students go to the board and write down. + Lan’s Malaysian pen pal came to visit her in Hanoi . Can you guess where she went and what she did during her stay ? + Ask students ... Date of teaching : September 13 th , 2007 UNIT 1 : A VISIT FROM A PEN PAL LESSON 1 : GETTING STARTED & LISTEN AND READ LANGUAGE FOCUS 3 I. Objectives : _ To introduce the topic an...

Ngày tải lên: 21/06/2013, 01:27

3 934 0
Unit 1_ A visit from a penpal

Unit 1_ A visit from a penpal

... places they visited. Answer these Qs.  Created by TTM_titiempi Malaysia Viet Nam Area Population Capital city Climate Unit of currency Official religion ( & others ) National language Compulsory ... its Arabic name, masjid Arabic. Date: ____________Name: _____________________ English 9_ Unit 1 Fill in each blank with one suitable word: 1. Japan _________________four main islands Hokk...

Ngày tải lên: 26/06/2013, 01:27

4 552 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT (Probe) atacgctcttactgtttccggccgcc BACT1369F cggtgaatacgttcycgg ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura. Environ.Tech., 14, 433-442. Park H D., Iwami C., Watanabe M. F., Harada K I., Okino T. and Hayashi H....

Ngày tải lên: 05/09/2013, 10:15

9 522 0
unit 1: A visit from a penpal- t3,t4

unit 1: A visit from a penpal- t3,t4

... the passage by showing the map and the picture about Malaysia. - T asks “What do you know about Malaysia. - T asks sts to read the passage silently and underline the new words. - T explains ... new word (translation method) - T reads the passage and students listen and find the right information about Malaysia to fill in the table. (pair word) - T hangs a cardboard and gets sts ......

Ngày tải lên: 16/09/2013, 13:10

6 632 0
unit1: A visit from a pen pal

unit1: A visit from a pen pal

... đọc to bức th c a mình September 10 th Dear, I arrived at Hang Co Railway Station at 9a. m. My aunt took me home by taxi . Ive visited HCMs Mausoleum. I was moved to tears when I saw Uncle Ho. ... vở Secondly: come from ship at sea Thirdly : garbage is Next: waste materials come from factories finally: Oil is washed from the land 4. Post listening - GV tổ chức trò chơi Chaigames vớ...

Ngày tải lên: 17/09/2013, 03:10

172 3,8K 4
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... of radiofrequency ablation versus medical therapy on the quality-of-life and exercise ca- pacity in patients with accessory pathway-mediated supraven- tricular tachycardia: a treatment comp...

Ngày tải lên: 03/11/2012, 11:44

9 679 0
w