Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

Báo cáo khoa học: Adipophilin protein expression in muscle – a possible protective role against insulin resistance pot

... results obtained in the present study indicate that adipophilin protein expression in muscle is involved in maintaining insulin sensitivity. Abbreviations Adfp, adipophilin; CLB, classical lysis ... University. Statistical analysis All data are expressed as the mean ± SEM. All statistical analyses were performed using prism software (GraphPad Adipophilin protein expressi...

Ngày tải lên: 06/03/2014, 09:22

13 373 0
Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

... alcohols 1.1.1.14 sugars 4.1.1.32 allosteric activation + 2.7.1.2 fructose- 1,6-bis-P 2.7.1.11 oxaloacetate glucose-6-P 2.7.1.40 citrate 2.3.3.8 oxaloacetate citrate A 1.1.1.41 glutamine ammoniaglutamate amino acid degradation Rhbg Slc 1A4 Slc 1A2 6.3.1.2 urea cycle 2.6.1.13 ornithine ammonia D urocanate N-formimino- glutamate histidine N-methyl- histamine histamine glutamate 2.1.2.5 4.3.1...

Ngày tải lên: 23/03/2014, 10:20

11 433 0
Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx

Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx

... that the term be a 81andsrd name. Because each standard name denotes the same individual in any context, knowing that a particular standard name is equivalent to a term implies that the agent ... illocutionary acts can be defined in terms of the kinds of inferences made, given a semantic analysis of an utterance, facts about mu- tual knowledge, and general principles of rat...

Ngày tải lên: 21/02/2014, 20:20

6 659 0
Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... equations, we might say that the process of translation amounts to making, in the target language, state- ments which heed all the signals appearing in whatever we or a machine are...

Ngày tải lên: 16/03/2014, 19:20

6 338 0
Báo cáo khoa học: Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates potx

Báo cáo khoa học: Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates potx

... Mistry PK & Abrahamov A (1997) A practical approach to diagnosis and management of Gaucher’s disease. Baillieres Clin Haematol 10, 81 7–8 38. 23 Weinreb NJ, Charrow J, Andersson HC, Kaplan P, Kolodny ... b-mer- captoethanol. Renaturing of separated proteins was accomplished by incubating the gel for 16 h at room tem- perature in a casein-containing suspension (2.5 gÆL –1 cas...

Ngày tải lên: 23/03/2014, 04:20

11 351 0
Báo cáo khoa học: Reduced FAS transcription in clones of U937 cells that have acquired resistance to Fas-induced apoptosis ppt

Báo cáo khoa học: Reduced FAS transcription in clones of U937 cells that have acquired resistance to Fas-induced apoptosis ppt

... M, Kimura A, Saito Y, Nagai H, Tachibana I, Matsumura I, Tanaka T, Kanegane H et al. (2004) Suppressor of cytokine signal- ling-1 gene silencing in acute myeloid leukaemia and human haematopoietic ... used: Fas mRNA, 5¢-AGATCTAACTTGGGGTGGCT-3¢ and 5¢-ATTTATT GCCACTGTTTCAGGAT-3¢; Fas pre-mRNA, 5¢-GGACC CAGAATACCAAGTG-3¢ and 5¢-GTCAGTGTTACTTC CCTAGG-3¢; TNFR1, 5¢-GTGCTGTTGCCCCTGGT CAT-3¢ and...

Ngày tải lên: 23/03/2014, 06:20

12 411 0
Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

... PAG, polynucleotide–adenosine glycosylase; PAP, pokeweed antiviral protein; PR, pathogenesis-related; RIP, ribosome- inactivating protein; SNA, Sambucus nigra agglutinin; SNLRP, Sambucus nigra ... (Saponaria officinalis L.), is capable of removing multiple adenine residues from various nucleic acid substrates including herring sperm DNA, mammalian DNA, genomic viral RNA, rRNA and poly (A) [1...

Ngày tải lên: 23/03/2014, 12:20

8 398 0
Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf

Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf

... siRNAs with the following sequences: 360 CAGCTTCCTCGTATCTACATTCAAGAGATG TAGATACGAGGAAGCTGTTTTT; 1179 CCATTCTGCCGTATATTGATTCAAGAGA TCAATATACGGCAGAATGGTTTTT; 1624 CTCAGAGATTGCCCTTTCTTTCAAGAGA AGAAAGGGCAATCTCTGAGTTTTT. The ... mRNA expression PHB and actin gene expression was also determined by real-time PCR, using as primers: PHB: 5¢-GATTTACAG ACAGTGGTGCACACA-3¢ (forward), 5¢-GGGTTCGTAT GGC...

Ngày tải lên: 29/03/2014, 08:20

13 447 0
Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx

Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx

... using a human hippocampal cDNA library, a different PDZ domain- containing protein was found to interact with serine racemase, also requiring the C-terminal binding motif [30]. Protein interacting ... moiety are shown in blue, whereas those involved in protein protein interaction are shown in green. The first four amino acids of the barley serine racemase and the final 88 amino...

Ngày tải lên: 30/03/2014, 04:20

8 402 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

... handling uses the FUF formalism and the same ratification machinery as the grammar. formation like (potential) accent and syllable boundary positions. Input to the synthesizer is a SAMPA ... for- mulations over the collapsed representation eco- nomical and relatively transparent. We note in passing that although collapsing multilinear data-structures onto a single tier increases...

Ngày tải lên: 08/03/2014, 06:20

5 498 0
Từ khóa:
w