A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

... Overview u A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD SUPPORTED BY A New Tool for Scaling Impact 19 sIBs sHould Have BIPaRtIsan aPPeal as ... commensurate with social outcomes and will range between 2.5 percent and 13 percent. 9 A New Tool for Scaling Impact Q 10 S...

Ngày tải lên: 06/03/2014, 08:20

... 1999 a new intravenous formulation (not yet available in Italy) was introduced in USA An intravenous formulation is available It needs an adjustment of doses if patient has renal impairment, ... patients which are at risk for TLS or have TLS and are allergic to allopurinol or cannot ingest it orally. The risk-factors can be related to the tumour or to the subjects with cance...

Ngày tải lên: 31/10/2012, 14:59

... Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation is a statement ... Gratitude and Abundance At the end of each day, recite this little poem: Thank you for the abundance, Thank you for the wealth. Thank you for all the happiness, Protection a...

Ngày tải lên: 15/12/2013, 06:15

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGC TACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAG...

Ngày tải lên: 07/03/2014, 21:20

... SN and Bindra RS. Targeting the DNA damage response for cancer therapy. DNA Repair (Amst) 2009; 8: 1153-1165 50. Shimada M and Nakanishi M. DNA damage checkpoints and cancer. J. Mol. Histol. ... Li Y and Cozzi PJ. Angiogenesis as a strategic target for prostate cancer therapy. Med Res Rev. 2009 [Epub ahead of print] 40. Mu P, Nagahara S, Makita N, Tarumi Y, Kadomatsu K, and Takei ....

Ngày tải lên: 26/10/2012, 09:48

... ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans. on Power Apparatus & Systems, ... 1. An arbitrary node (for example node a) is selected as start node. 2. A not search node adjacent to node a (for example node k), is selected. 3. For each node...

Ngày tải lên: 03/01/2014, 19:35

... industry and the media. The main reason for this is that the VR technology has become available at an affordable price so as to be considered a viable tool for interactive design and ... the PC platform, as opposed to the UNIX platform. This also has an important practical advantage in that a much Fig. 14.2 VR system architecture. wider (and cheape...

Ngày tải lên: 23/01/2014, 07:20

... efforts to accommodate changes in forests due to climate change. Two well-established conservation approaches that are likely to be a useful tool for climate change adaptation in forest management ... restoration, we refer to actions that resource managers and others can take to actively facilitate the ability of species, habitats, and ecosystems to accommodate climate...

Ngày tải lên: 25/01/2014, 20:20

... decisions. 1. A “cost” band is a range of unit price. Each NIIN falls into one cost band. There can be as many cost bands as desired. Each cost band can have a different CWT goal and, along with ... for stockage based on the ap- propriate add/retain criteria (see Table C.2). For NIINs that qualify based on demands, the system and user parameters that can override the demand-ba...

Ngày tải lên: 17/02/2014, 17:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, parafor...

Ngày tải lên: 18/02/2014, 17:20