Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL Elena S. Bochkareva, Alexander S. Girshovich and Eitan Bibi Department of ... that maintenance of the correct folding state of GatY in E. coli probably requires the assistance of two chaperone systems. The identification...
Ngày tải lên : 22/02/2014, 07:20
  • 9
  • 548
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

... Protein kinases and phosphatases that act on histidine, lysine, or arginine residues in eukaryotic proteins: a possible regulator of the mitogen-activated protein kinase cascade. Pharmacol. Ther. ... A ˚ ke Engstro ¨ m at the Peptide Synthesis and Analysis Laboratory of the Department of Medical Biochemistry and Microbio- logy, Uppsala University. The SP6 primer...
Ngày tải lên : 21/02/2014, 01:21
  • 8
  • 666
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipper domain and fork-head domain of foxp3. In addition, for stat6 and ... interactions between STAT dimers on adjacent DNA-binding sites, a coiled-coil STAT protein all-alpha domain, which is implicated in other protein protein interactions,...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... nm and 680 nm filters. SmSmad1B protein interactions Yeast two-hybrid and three-hybrid assays The yeast strain Y1 90, a HIS3 ⁄ LacZ reporter strain, was utilized in the yeast two-hybrid assays. ... of the TGF b–activin pathway include Smad2 and Smad3. The R-Smads of the BMP pathway include Smads 1, 5 and 8. The type I receptor phos- phorylates the R-Smad at its...
Ngày tải lên : 18/02/2014, 16:20
  • 19
  • 653
  • 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosyn- thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways, respectively. The ... Further identification and quantification of puromycin were achieved by a Pac enzymatic assay [21]. Preparation of 3¢-amino-3¢-deoxyadenosine 3¢...
Ngày tải lên : 21/02/2014, 01:21
  • 9
  • 728
  • 0
Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt

Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt

... Identification of syntaxin- 1A sites of phosphorylation by casein kinase I and casein kinase II Thierry Dubois 1 , Preeti Kerai 2, *, Michele Learmonth 1 , Andy Cronshaw 1 and Alastair Aitken 1 1 The ... (reviewed in [17,18]). Syntaxin- 1A is associated with the presynaptic membrane and associates with the plasma membrane protein SNAP-25 and the synaptic vesicle pr...
Ngày tải lên : 22/02/2014, 04:20
  • 6
  • 403
  • 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... Cloning of sipU HV11 TTRTCNCCCATNACRAARTA Cloning of sipU U1 TTGAAYGCNAARACNATHACNYTNAARAA Cloning of sipU V1 TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipV V2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipV V3 ... TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipW W7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipW W8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipW W9 GGCGATGTCATCACTTTTACACAA Cloning of...
Ngày tải lên : 21/02/2014, 03:20
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... N-acetylornithine transaminase; GAT, glutamate N-acetyltransferase; AOD, N-acetyl- ornithine deacetylase; OCT, ornithine carbamoyltransferase; ASS, argininosuccinate synthase and ASL, argininosuccinate lyase. Wild ... The pathway of citrulline and arginine biosynthesis. AGS, N-acetylglutamate synthase; AGK, N-acetylglutamate kinase; AGPR, N-acetylglutamate 5-phosphate reductase; AOAT,...
Ngày tải lên : 20/02/2014, 03:20
  • 12
  • 649
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... 2000-fold increase in specific activity. Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater ... hemagglu- tination assay. Preparation of asialo-erythrocytes. The procedure fol- lowed for preparing asialo-erythrocytes was that of Mercy and Ravindranath [2...
Ngày tải lên : 21/02/2014, 00:20
  • 8
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... N-terminal Ôtwin-arginineÕ signal sequence that is characteristic of cofactor-containing proteins translocated into the periplasm via the Tat translocase [27]. As deduced from the N-terminal sequence ... o CO 2 [11]. Acetate is oxidized to CO 2 by a modified acetyl- CoA pathway using typical methanogenic coenzymes [12,13]. Some of the reducing equivalents generated in the oxi...
Ngày tải lên : 21/02/2014, 03:20
  • 10
  • 564
  • 0

Xem thêm