Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

... perfor-mance of WSD algorithms for languages such asEnglish for which hand-crafted sense -annotated corpora have been available (Agirre et al., 2007;Erk and Strapparava, 2012; Mihalcea et al., ... amount of data that canreasonably be annotated by hand.Leacock et al. (1998), Agirre and Lopez de La-calle (2004), and Mihalcea and Moldovan (1999)propose a set of methods for automatic harvestingof ... Wiktionary datawas extracted by the freely available Java-basedlibrary JWKTL5.3 Creation of a Web-Harvested Corpus The starting point for creating WebCAGe is anexisting mapping of GermaNet...

Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... representation languages as FRL, KLONE and KIIL. Frames have played dual functions. They have been used as a way to organize the inferences, and also as a structural representation of what is ... deposits and withdrawals, and the final balance." Assume that we parse these sentences into our favorite internal representation. Now what we do with the internal representation? It ... Orsanizai::Lon • "ne parser is essentially based on semantic markers and parses a sentence in to a case frame structure. The specialists contain contextual knowledge rele- vant to each...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-speciﬁc...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 107 3–1 109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... angiotensin-convertingenzyme, produced by actinomycetes. J Antibiot (Tokyo)38, 181 3–1 815.33 Aoyagi T, Wada T, Iinuma H, Ogawa K, Kojima F,Nagai M, Kuroda H, Obayashi A & Umezawa H(1985) Inﬂuence of angiotensin-converting...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... hD1 hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre...

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... combination of IFNa and TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL onthe DNA content of MCF-7 cells was also assessed,using ... TRAIL. In other systems, increased apoptosisseen in response to IFNa plus TRAIL is characterizedby elevated caspase-8 and caspase-9 activity, with enhanced degradation of BID and translocation...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was ampliﬁed with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... truncated fragments of TbPDE1were also ampliﬁed using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was ampliﬁed using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ ... locus A genomic DNA fragment containing TbPDE1 wasisolated from a k-DASHTMlibrary constructed fromgenomic DNA of strain AnTat 1.1 which had been partiallydigested with Sau 3A and packaged with...

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed andquantiﬁed on a Fuji Bio-Imaging analyzer BAS-2500 usingIMAGE GAUGEV3.3 software.Chromatin and protein–DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavageby ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against speciﬁc modiﬁcationssuch as acetylated H3-K9 (Cell Signaling Technology) andH3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... yeast. Proc. Natl Acad. Sci. USA 97, 1370 8–1 3713.52. Rascle, A. , Johnston, J .A. & Amati, B. (2003) Deacetylase activityis required for recruitment of the basal transcription machineryand...

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... NorthAmerican Chapter of the ACL, pages 15 4–1 62.Joel Tetreault, Elena Filatova, and Martin Chodorow.201 0a. Rethinking grammatical error annotation andevaluation with the Amazon Mechanical Turk. ... corpus Ryo NagataKonan University8-9-1 Okamoto,Kobe 658-0072 Japanrnagata @ konan-u.ac.jp.Edward Whittaker Vera SheinmanThe Japan Institute forEducational Measurement Inc.3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004;Nagata et al., 2005; Nagata et al., 2006; Tetreault etal., 2010b). This is one of the most active researchareas in natural language processing of learner...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum-marization framework as well as a novel audiovis-ual presentation of art. MemeTube is designed as a ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...

Xem thêm